Description :
From Genome Similarity Track
Location :
Scaffold_749:6694- 7950
Transcript NameFunction/comments
Physo_126182heat shock protein 70

Sequence
1256 bases(100 bases per row)
CGGCCTCCGCCACCATGCGGTCAATGTCAGCCTGGGACAGACGGCCCTTGTCGTTCGTGATCGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGC
CGACACGTTCAGGATGCCGTTCGCGTCGATGTCGAAGGTCACGTCAATCTGCGGCACACCACGGGGCATGGGCGGGATGCCGTCCAGGTTGAACTTGCCC
AGCAGGTTGTTGTCGCGGGTCATCGAGCGCTCGCCCTCGAAGACCTGGATCAGCACACCGGGCTGGTTGTCCGCGTACGTCGAGAACGTCTGCGACTTCT
TGGTGGGCACCGTCGTGTTACGGGCGATCAGCGTCGTCATGACACCGCCGGCCGTCTCCAGACCCAGAGACAGAGGCGTCACATCCAGCAGCAGCAGGTC
CTGCAGCTTCTCCGACGAGTCGTTGCCGCTCAGGATGGCCGCCTGCACCGTGGCGCCGTACGCGACGGCCTCGTCCGGGTTGATCGACTTGTTGGGCTCC
TTGCCGTTGAAGAAGTCCGACAGCAGCTGCTGCACCTTGGGGATACGCGTAGAGCCGCCGACGAGGACGACCTCGTGCACCTGGCTCTTGGAGAGCTTGG
CGTCACGGAGCACCTTCTCCACGGGCTCCATGGTCTTGCGGAAGTAGTCGCCGCACATGTCCTCGAAACGAGCACGGGTGATGGTCGAGTTGAAGTCAAT
GCCATCGAACAGAGAGTCAATCTCAATGTACGCCTGGGCCGACGACGACAGCGTACGCTTAGCACGCTCGCAGGCAGTCCGCAGACGACGAAGGGCACGC
TGGTTCTCAGTGATGTCCTTGCGGTGCTTGCGCTTGAACTCCTGCGTGAAGTGGTCCACGAGACGGTTGTCGAAGTCCTCGCCGCCCAGGTGCGTATCAC
CAGCAGTAGCCTTCACCTCGAAGATGCCCTCCTCGATGCTCAGTAGGGACACGTCGAAGGTGCCGCCACCCAGGTCGAAGATCAGCACGTTGCGCTCGCC
GCCCTTCTTGTCCAGGCCGTAGGCAATGGCCGCGGCCGTCGGCTCGTTAATGATACGGAGGACGTTCAGGCCAGCAATGGCACCGGCGTCCTTGGTAGCC
TGACGCTGCGAGTCGTTGAAGTAGGCGGGCACCGTGATCACGGCGTTCTTGACCTCCTTGCCGATGAAGGCCTCGGCCACCTCGCGCATCTTGATCAGCA
CCATGGACGAGATCTCCTCGGGCTGGAACGTCTTGGACTCGCCCTTGAACTGCACC