Description :
From Genome Similarity Track
Location :
Scaffold_5:669264- 687969
Transcript NameFunction/comments
Phyci_76708Hypothetical protein
Phyci_158591hypothetical protein
Phyci_210065Hypothetical protein
Phyci_209851Rab7 family GTPase, putative
Phyci_491938Hypothetical protein
Phyci_209873Hypothetical protein
Phyci_209584Hypothetical protein
Phyci_89755Hypothetical protein
Phyci_300272indigoidine synthase A family protein, putative
Phyci_89756Hypothetical protein
Phyci_24232Hypothetical protein

Sequence
18705 bases(100 bases per row)
CACCTTAAATAGTAAATACTCCACTGCTGCTGCTGCGTGTCCCTCGCCCCGATCAGCTACAGGACAAGCTGGCGGTCGAGTCGTCGCTGAAGCTCAAGGA
CGCGAGGCTGTCGCTCTCGCGCtcgtcgtcgtcatcgctctcgcgctcgtcgtcgtcatcgctctcgccctcgccgAAGAAGCTCGAGGACGAGCAAGTG
CTTCCGAgcggcgcgtggcggcgcgcgggccggcgcATGGCCAGCATGCGCAGGTCCATCTCGCGGTACATAATGACGCTCCACTTGCACTCGCCCGAGC
AGTAGCAGTCCACCTGGTCGTCGGGGATCTGCAGCGAGAAGAAGGACACGCCGCAGTTGCTGCACACGAGCGGCAGCCCCGAGACGCTGGGCCGGCGCTC
TCCGCCGGCGCAGCAGTCGTCGTCGTCGGCCTCGTCGTAGGGCTCGGAGGCCGCCATGAGCGCCAGCACCTCGAGGTCCACGGCCTCGTCCATGGTGCGC
GCCGAGCCGTCCGAGCGCGCGTCCGCGTCCTGCGCCGGCTTGCGGCACAGCCAGTCGCACGCCAGGTAGCCGAGGCAGTCGCCGCCCGCGCCCGCGCTCG
CCTGGGACACCATGTTGAAGCCGGCGGGGGTTTCCGTGGCGGCAGTCTGTCGGGCCGCGGTCGCGCCCTGCTCGCGGCAAATTGCAAAGTGACCGAGTCC
TGCTTGGCCCGAGCGATCTTTGTTCCGCTTCGTATAGCGCCGACTATGGGGACTGGGCTTCGGGCGGTTTGCTcgcgccgagcgccccccgtgccgctgc
cgtgccgcgccctgtcgcccagcgccgtgcGAATGTATGGCGGGATCCGCTGCGTCCGCCAAGGGTCGCCATTTTAACGCGGGCGGGCCAATCGCAGCCC
GCGTCTGATAACGTACCGTACGTTCCGCAGCCGGCGCAGAAACGGGCCGCCGCCGCCCATTGGCCCAAAACGCGTTTTTCGAACAAATTGGGGGAAAAAC
GCGCGCCGCTCCGCCGCGAATTCAAATTCAAAACCAGAGGCTCGGCTCGGCTCGCGGCGGCGATGGCGGTtgctgctgctgctgctgctgcCAGCGGTGC
TGCTGGCCTGTTTCCAAGCGCAGCCAGCTACGCGCTGCGCGTAggcggcggcggcggcggcggATATATGCAGTGCCGCCCGCGAAGATCTTCCAGCCGG
TCTTCCAGCCGGGCGTGGACAGCCGGCGCCGGCAAAGCCCTGTTGCGAGCCGTGTCTCGCCGCGGTGGGTTGCTGCGGGGTCGTGCCGCCGGCGTGGTTG
AAGTGAACACCCAGCTGGGCCTGGCAAATTGCCAGGCCTGTGGCAATTCGTCAGCGCACTGGGCGGGGCGTCCGCGGTCGGCGGACTCGGTTTCCCCGCC
GTTTTGCGCGGTTTCCCGCGCATTTCACCCCCGGCGCCGAGTCAGCGGAATCAGCTACGGTGACGTCGCGCAAAACGTCTGAGCCAAAGTCGGCTCGTGA
CGCACAGCGCTGACCCAATCGCGCGCGCTGCTTGGGGCCTCGGTCGGAGCTCATTGGACCGCGCGGCGCCAGCGCAGTTTCGAGCGCCGAACTTGCCGCA
ACGGCGAGCCAAGCGCTCATGAGGCCGGTCCAGCTTCCATGGTTGCCCTCCAGCGGCGCGCAATGCCGCTCGCACGACCATTATCGAAACCGGGTGAGAT
AGCGCGATGGCTTCGCTTTTTGCCGGCGGTAGACAAACGTGGAAGAATGGTCCCGCGTGGACCGCTAGGCGGACGAGGTTCCGCTCACAGACAGCCCACG
GCTAGGCCTTTGCATTGCCGGCAGTGACGAGAACCAACGCCACAGCGGTCGTGTGCTCATAACAAACGGTGGCATCACCGGCAAGCCATCACAAATCAAC
CCATGCGTGGGGCAAGTCTTCATTTGACTTGACACGCCTCGTGAAACGCATGCGGGGGCTACTATGTTCACCCAAACCGTCGGCAATGTGCTCCTCTGAC
TAAACCGTAGTCGCCACCGAGCCGCACGCTTGCTACAGCAAAGCTTTCGACACTCGGGAGCGCATGTGGCGCCGCGCCCCGAGCCGAGGAGACCCGCCCG
ATGCGCGCCATGTGGCTCGCATTGCTCGACGGCGACCATGAAAGATCGCGCGGGTGTGGTCCACATCTTCAGGATCAGGTTTGGCGGGGGTGTCGACCAC
CCACAAATCATCTTGGGCGGGCTCTGGCTTCCGATTATAATAGCGCGCATTTTTTCAAACGCGCCATACTGAGCGCAAGAGGATCGAGTATTAGCTCAGA
CAGAGCCTGCGAACCATGGCGACGCCCAGCGGCATGTCCGCTCCGAGGCCCAAGGCGCGCAGCACCAACCTCACGCACGAGCAGAAGCGGCTAATCTGCC
TGCACGCGCGGCAGTTCCCCAAGACCACGCAGGCGCAGCTGGGCCAGTGGGCCAAGGAGCAGTTCAACCTCGAGTATGTGCCGTCGCAGGCGGCCATGAG
CTACATGCTCAAGAAGCGCGCGCAGTTCGAGCTCGTGTCGGGCGAGGGCCGCGACTACAAGAAGCTGCGCACCGTCAAGTGCCCCGAGGTGGACTCGGCG
CTGGCCAACTGGTTCCTCTACTGCCAGGCGCGGCGCCTCAAGCTGCCGGGCGACCTGGTGCGCCACAAGGCGCGCGTCTTCTACGAGCTGCTGGCCCCGC
AGCTGCCCGAGAGCGTCACGAGCGCGCCGCCGCAGTTCTCCAACGGCTGGATGCACTCCTTCATGGGCCGTCACGGCTTCTCGCTGGGAGGCGGCAAGGG
CAGCAAGGGCCGGGCGCCGCGTGCGCAGCAGGACGACGTCGACGGCAGGCCCAAGTTCGCGCCGGAGACGTCGGTCATCACCACGCCCGACCACATCAAG
ACGGCGGTCATGGGCGTGCCGCCCGAGAACGTCTACTGGCTGCACGAGACGCGGCTGTTCTACGCCATGAGCCCCGACAGGCAGGCGCTGCCCACGGGCC
ACCACCCGGAGAAGAAGCTGACCATGTTGCTGGCGGTCAATGCCGACGGCAGCGACAGACTCAACCCCTTCTTCGTGGGGCCGCACGCGCTTCCCGCAGA
CGTTGATGTAAACGCGGAGGACCGGCAGTACCAGTTCGCCTGCAACCACAAGGCCTGGGTGCCGCCCACGATGCTGCGCGACTGGCTCATGGCGCTCGAC
TGGCGCATGCGCGTGACCAACCGCCAGATCGTGCTCATTGTCGACTCGGTGGCGGCGATGAGCGTGCAGAAGGCGACGATGTCCAATGTCAAGATGCATT
TCGTGGAGCGCAATCACGCTGGAGAGCTCTGTGTGCGAGCTCTGGAGATGGGGATCGTGGCGGCGGTGAAGCGTCGATACCGCCACCAGCTCTTGGACTT
CGCGCTCGATCGACGAGAGGAAGGCCAACTCGATATCTACGATGTTCCGTTGCTGAAGGTGGTGGAGTGGGTCACGCACGGGTGGCAACAGATCCCGCGA
TCACGGATTATGGCGAGCTTCGCGCATATTGGAGTTATGGTGACTACAGAGACAGGAGCAGAGGTTGTGCCGGACAACCGCATCGATGACAAGCTGGACG
CGCAGATCCAAGCGTTGCTGAAGCGTCTGAAGCTCGTCAGCCCCATGCGGCTGATTGAAGTGGTTGCTCCTACTTCCGAGAGGGCATGCGACGAAGACCT
CACAGACGCGGACTTTGCCGACTCGGCGCTCCACGCTACACAGGGCACGGTGGGGATGCAAGTTAGTACGGAAGATCTCACTCGCCACACGATCACACAG
GTGGGAGCAGGCTCGTCAGCGGAAAACTCCTCGGGCTCCTCGACACCGTTCGACGCGCAGGGAGGATCGCGCTCCGTTGCTCCCCGTCGCAGCAGTAACA
GCACTGCTGCCAGCAGTTTTATCAGCGACTATCCTGGCTTTGACCAAGGCTACCCCGGTTCGTTGGACGACACTTGGCTGTCGTGGACTGCAACGCAGCG
TACTGCGACGGCCCCCGTCCGCCAGCCTGTGAGCGACTTGGAGGCCGTGCAGACGACGATCCGCCTGGCGACCGAGATGAACTGCGACGCCGTGGTCATG
ATAGAGCTCAACCGCATCCACGAACAGGTGGCGAGCCGCGACCCGAGCTCCTCCAGCTCCACGGCGCTGACTGCTCCAGCTCAGCCGCCCTCGCGCAACG
CTGGCATCTGCCAATTCCGCTTCGGAGCCCCCACTCGGCGGCTGCTGTAAGCCTGGAGTCCAGTTGACCAGCACGGGCTTGTTCGTTATCATTTTGCGTG
ACACCACAGCAGGATAGTTTCAGTGTAGCCATGTCCGCTTCAACTTGCCTATGATTGGCGGAAAATCCGGAGAAAAGATTTTCTTTTCTTCGAGTCTTCA
TCCCAATCAAAACATTTAGCGGCGAAGAAGGCACAGGTCTCGCTTCTCCTTGCCTGTGCACTAGCGAGCGACACAGCAGTACACGCAGCCAATATGTCAC
ACCGCAAGAAAGTGCTGCTCAAGCTGATCATCCTGGGCGACAGCGGGTGCGCGCCCTCTTGCTCTCATGCTTGATCTGCAGCCCTCTCTGACCCGTGTAT
CATATCTGTAAATGCGTTGCCAGCGTGGGCAAGACGTCGCTGATGAACCAGTACGTGAACCAGAAGTTCAGCAACCAGTACAAGGCCACGATCGGCGCCG
ACTTCCTCACCAAGGAGATCATGCTGGACGACAAGCTGGTGACCATGCAGATCTGGGATACGGCCGGCCAGGAGCGCTTCCAGAGCCTGGGCGTGGCCTT
CTACCGCGGCGCTGACGCCTGCGTGCTGGTCTACGACATCACCAACCCCAAGGTGCGGGGAGCTGCAGGGGAGGTGGAGAGGTTTAGACGTCGGGTGTGC
TGACTGTGTTGCTGCTTGCTGTGCTGCAGTCATTCGAGAAGTTGGACACGTGGCGGGACGAGTTCCTGGCGCAGGCGGGGCCGAGGGACCCGGACGCCTT
CCCGTTCATTGTGCTGGGCAACAAGGTGGACAAGGAGTCGGAGCGGAGGGTGGGTAGATCTGCGGAGGCAGTTGAGAGCAGGGGAGGAGGTTGCTGATAA
TTGGGTTGTCTTGTTGTGGCGGTGGTGCAGGTCCAGAAAGAGAAGGCACAGGAGTGGTGCCGCTCCAAGAACGTTCAGCAGGTAGGGGTTGAAGAGTTTG
CTGTTGGAGGAAGGTGTGTCGGTCGGGATATTGATGCCACGTGATATATTGGTGCAGCCTATTCAGCACTTCGAGACGAGTGCGAAGGAGGCGACAAGTG
TGGAAGAGGCCTTCCAGACGATTGCAAGCTCAGCGCTTCAGAAGGGTCAAGAAGATGACATGTACGTACAGCAATGATTCGCTACGCTGAAGTTGGAATA
CTGTGCGGTGAGATGACTTGATGGTTGTGGGTTGATTTTGTGTTGTTGCTGTAGCTACGTTCCGGAGACGATTGATCTTAGTGGCACATCGTCGAAGCGC
GAAAGTTCTTCATGCTGTTAAGCATCATGGGCCGTGGGAACTGGCTCGGCGACAACGTGAGTGACAACAAGGTAACGATGGCGTGGAAGGTGGTGACCAG
AGAGCAAATAGTAGAGGAGCTGGCCTGGCTAGACGAATGTAGCTCTGATCTCACTATTGCTGGAGGAATTCATTTGTCAGATTTCTTGGTTTCGTCCTTT
GGTGTTGGTTTTTGTTTGCTGTCAGAAGATGCTAGCTTCGCTACTGGCGACGGGTGCTCGATTGCAGTTTTAGTTGAGCCTCTCAAAATTCCTCCAAGAG
ATAGAGGTGGTACTTGGGTCCGCTTCTTCTTTTGCTTCTTCAGCGCTAGACGCTCTGCTTCCAGCTGCTGGCGCCGAACTTCGATCCGCCTTTGTACTTG
AATCCTTCGCCAACGGCAGTAAACCTTGAGCTGCGCTGCAAGTTCCACGGCTTCCTCGATATCTCGAGTTGGCACCGGTTTTGGAGGACCGAACTCATAT
CGACCCCATTCCTTTGGATCCACCTGCTGTTCTTCATCGGTGGCGATCATGTACTTACGAAGCTGCTTCTTGCTCGTCTCACGAATTGTGATTTCTCGCT
TCAGGAACGTCAGCTCTCTGGCAACAACGTTTGGTTCCTGTTCCCGATGGCGACGCAAGAAGTCCTCAAGGGCTAGCTTACTGAATTCATCAGGTAAAGG
CAAAAGGTTACGGATGTAGGGTAATGCTTACCTTTCGCGTGATCAACTGGACGAGGCCCCCGATACTTCCTCACGGGTGACGGTGGCGATGTGATAACCT
CCTCGTTTTCGGGAACTGTCACCCTGGCCTCCTTGGCCATGTACTTCCGAAGTTCCTCCTGCTGGCGGAGTTCAACCTGGTCGCCATGACAGTCTACACA
GAGGTAATCCTGCTCTGGGTCTCCGAGATCGCCGCAGCCTGCGCGGCATTGAGCCCTCACGTGGGCACTCATGCTGATGCCTTCAACGAAAACACGGACC
AAATACACGCGAGCCCACCAGCGTTGTAACTGCCGCAATGCAATAAAGCAGCTCTCAATTTGGACACTTCGTCTTAATGCTGCATGGTCCTTTGGCTGCA
CGTCGTCTCTAATGCGACTCACTGGGGGAAGAAGCTACGGCGCTTTGGGGTCTTGCAAATAGAACGGGTGGAACGAGATCAAGCCGCTGCTCCAGGCAAC
ACTCAGCAGCGCTCCATGCTTGAAATTCGAGGCAAATGCAAGCTTCCGCGGTACGCCGGCGTTAGGAGGCCCGCGCAAAAGGCCACTGTAAACGTATCCA
TGTTAGTACATGCGCTTCGATAACTGAAATGAAGCAAGAAGCCACAAACCTGCGTGTGAAAATGAGGAAAGGCTCCCAAGCCACACTGAAAATGGCGACC
AGTTTCGAAGTACCAGCTTGGTGGGAACCCATGGCCGTGGTCCTATACGTGACTGCTACCCTTGTTCCACTCGGGTCCCAAGCGATGTTCTGAACGTTGC
CGCCAACAATGCTGAGATTATGAACAACAAGTAGTCAGCCACTGAGCAACGACATTAAAATCCTAGCGATAACTTACGCTGAGGTGCTTCGGTCGAGCGA
AAACAGCTCCTTCTCATCGAAATCAAGAGCCGGTGAACTAATCTGTGCGTCTACATCAACCAAATCATAAGCAAGTAAGTATTTGTTTCCATGCATATGA
AGTCAACAGCGTATCATACCTATCGAAGGAGGGCAGTCTTGGAAAATGTACGGGTACAGGAGAGCGCTATTACGAAGCGCCACGAGCATGCACCGACCGT
CGCTCGACCATCCGCAGCCCTGCAATATTAAGAGGAAGAACGGCACACTGAGTACAGCAGTAACGAATGTGCTCACACTCACTTCGGTAGCATAACGTAC
CCCAGCCGCAACCTCCCACGTCTCCCTCTTCCACGTGAGAGTCTCCCACATCAACGACACGCCGCTTCTGAATAACGACAAGCACATACACACAAATCAG
CAAACAGCCCGGCTTCGGCAAAACCCACTAACTTTGCACCTCTTACTCTGTGGTCACGAATAAATACTCGCCAGTAGGCGACCAATGCAGCGCCGACAGC
TTGTACGGGCTCTGCAGCTCGGTCTTCCTCGAGAAGACAGCGTCGAACACAATCACCGCCTTGGATCCCTTCCCGAACGCCGCCAACAAGCTGCCGTCCG
CATTCCAGCACACCTGGCTGAACGGCGCGTTGCTCGGGTGCTTCAAGATCTCCAGCAGCACAGGCTCTGCAAAAAAAAAAAGAAATCAGCAACACGTCAC
CACCAAAGCTCAGACCCACCCCACCAACGCCGCACCTTTCTCCTTCGGCGGCACCTTCCACAGGAACACGCCGAACCTGCAGGCCACGGCCAGCGTGTCG
CCCGTGAACTTGCCCCACTCGACGCTGCCCACGTCCACCTGCTTGGCGTGCTCCAGCACGCGCGCGTCCCACGTCGCGCTCTCCACGTGGTAGAGCGCCA
CCACGCCGTCCAGCTGCGCCACGGCCAGCAGGTTCCTGGTCGGGTGCCAGCTCAGGTCCACGATGCTCTCGCCGGCGTCCGCCGCCAGCTCCGCAGGCTC
CAGAGGCTCCAGCTCCTCGTCCTCCGCGCCCGTCGCGGCGCGCAGCAGGCGGTGCGCGGCGCCGCCCGCAGCCTCCAGCGCCGCGTTCAGCAGCTTCAGC
TCGTCGTCCAGCAGGAAGCTGCGCGCGCCGCGCAGCCCGCGCTTGAGCAGGCGCAGCGCGCCCGAGTCCAGCCCGTCCTCGTCCTGCTCGTCGGTCAGCG
ACTCGCGCTGGCCGAAgggccgcggccgcgcgctggccacgcgcgccggcgggAACACACATCCGCCGCGGCGGATGAACTCGTCGCCCGCGTGCGCGTC
GTCGCGCTGCGAGACGCTGTAGAGCTCGCCGTGCAGCTCGCCGAGCGTCACGGCGTCCTCCTTGGGCACGACCCAGGTCATTGGCGAGTATATGCAAAAT
GTGTACGGATGGTGTGGCGCGGAGGTGTCACTGAAGCGAGGGAGAGAAGGTAGTGACATGATACTTTGCCTTTGGACCCAATGCGGGTGGAGGTGGAGGT
GGCGCCGTCCGCCGGCATCTCCAGCGCCGCGTACGTGTCGCCGACGACGTTTAGGAGCTTGAATGCTGCGTGGGGGTGCTACGTGTCGCTGCGACGCTGT
GGAATGCATCGAATGCGCGTTTTTCGACTGGAAATCGACGAGAAACTTGAGGAATACGGAGCTGTCAAGGTCCGCATCGACCACTGGCCCGAAGGAGACA
CAGAAGGAAGCTGCAACGCAGTGAAAACAGGAGGTGGAGTGGAGGTGGAGTGTATATCGCCATCGGAAGTAAGAGTGGTGCAGTACTTGGCGCTTGCGCC
CGCGGGCGACAGCCAGCCGAAGCTGGCACTCCCGTTCGTGCGGAGCTTGCTGCGTGGACGGATTCTTAGTGGACGAGCTGGCTCCATTGCCCTGCAAAGT
GACGGACTGGATTACGGTCGATGGACGTACGAGGCGTTCTTCCGTGGACGCAGAGCGGAGGACGGTGCACTGGAGTTTGATGGCGGAGTTGTGACGGATC
AAACGTTGGTGTTGATGTTCCCGTCTGCTTCGACTGCATCGTCGAGAGGGGAACCCAAGTATCAGCCGGTTGGAGCTCATGCGAGAGGGTTTAAAGAACT
GGTGGCCATGGCTCTTCGTGGAGTGGAGATGCCGGGCGGTGACGATGCACATGGAGAGGCGAAAACTATCGCTGCTCCTCACTCGTTGCTGCTGCATGCA
TCGAGTGGCGCCGGAAAGACGACGTTGGTGCATCAGATCGCAAAGGAGCTGCTGGCGAACTTGCTTGTAATTGACGGTGGATTGTTGGCGTCTCCACAAC
TGAGACTTGAAGATTTCTTCTCGGTTGCCCTGCGGATTCAACCGTGCGTGCTGCTGCTCGAGGACCTGGAGTTGCTTTTCCCGATGACGCTGGATGAAAC
CAAGTACACGCTTGTATGTCGACTCGTCAGTTGTCTTGAGAGCATTCGTAAGTTTGCTTGTTGTGTTGTGTTCTTCTTGCTATGAACTCACCGCGTTGAG
GTATGTTACGCAGAAAAATCGGAGTCTGTGCGGGTCGCTGTAATTGGAACTGTGTCGGTACTCGGCACTCTCCACTCAAAAGTGCGACAGTTGTTCACTG
AAGAAGTTTTTCTCGATGTAAGTGGGCTCGCATATGCTATCTGAAGCTCCCAGGCTATCGTCTAATCTAGAGTGTATGTACTTTCATAGGTTCCTGACAA
GCAATGGACATTGGATTTGCTAACGTCGTTGCTTCCGTCGTCGAATACACTGCGACCCGAATTCCTGATGTCTTTAGCCGTCCGATACGGCCAGCGGCCA
AGCAACATTGCCGCGATCGCCCAACAAATTGGCGTACGTCTTACCCAAAGTGACAACGAAGATATAAGTGTGGCAGCACTTGAATCAGAGATCTCTGCAA
CTGCGCGCAAGATCTCTTCCACAAGCAATGGGGCGGATACTCTAAGTTCCTCTGTGCCTGACGTGTCGTGGGACGATATTGGCGGCTTAGAGTGCGTCAA
GCAAAACTTGATCGAGATGGTGGTGTGGCCACTGGAGAAGCCGCAAGTCTTTCGCCGCATGGGAATCTCGCCGCCATTGGGCATGGTGTTACATGGTCCT
CCTGGTACAGGAAAGACTATGCTTGCCAAAGCAACAGCGAAGGCGAGCGGTTGCAATTTCTTGAACCTGGCAGCTAGCGACCTTATGAAGGCTGAGATTG
GTGAGAGTGAGAAAGCAATTACACGCGCTTTCGATACAGCCCGGGCGCTAAGTCCGTGCATGATTTTCATCGACGAATTCCAATCACTATTCGGCAATCG
CTCAACAGCCGGACAAACAACATCTCGGATGATCTCACAGCTTCTTATGGAGCTTGATGCTGTGAAGGCCGTATCTGACGACAGCGAGATGCATAGCAAC
ACGACTGAACCTCCCGCAATGGGCAGCATTTCAACTGGCCAAATATTTGTTCTTGCAGCAACCAACGCTTTATCTGCAATTGATCCCGCCTTCCTCCAAC
CAGGTACACATTCGTGATACAAATCTGTCCGTTGACTGATTTTAACTGGCGTGCTTGACTGTATTTGGCGTGCCCAGGCCGCTTTGAGAATGTTGTTTAT
GTTGGCTTGCCCAACGCCAGCGAGCGCAAATCCATTCTTGAAATTCAGCGCAGTAAAATGCCATGGAGCCAAGATGTTGACTTCGCAAAGCTCGTCGAAG
AAACTGATGGCGCTAATGCGGCATCTTTGATCGCGTTGTGCCAGTCTGCAGCAATCCAGGCCATGCAACGGATACCGCCCAACGCCCCAGTGGACGAACA
GGTACAAATTTGGCAGCACCATTTTTTACGTGATGCTATCGACTGACACGAAGCTTGTGTTTGGTACAGTGCATCGCAATGGCTGACTTCGTCGCTGCGT
TAGCAAAAGGCAACTTTGATTTTCAAAAATCCGCTTAATAGACGAAACAAAGCATTTGAAGAGGAGAACCTCAGCAACGGAAAGCAATGGCGCCGTTCAT
TTATCGGAACCGTCATCGCCAGACTATTCTCTAAGTAGCAAAGCTCGCGTACGCACGCAGCGCCGTTTTGACGCCTGGGGGGAACTCGAACAAGGATAAT
TCGCCTTGAAATACCTCCGTGATGCGATAAATACCGCTGTCGATTCCTGTAAAATAAAGGATCGCGGGTTAGCCCACCAACTTTACACTTGCAACCAACA
AGCAAGCAAACAAACCTTTTGCTAGAGCAGTGGCTTCTTGGACGTAAACATCATTAGTACTGCTCTCCTTCAGGCACGTCTCCATGTACGCTTCCAGCGC
ATTGCGGCACTCCATCAGTGATGAAAGCACTGCCGGCACAGTGTGCTGTGGTATACAAAAGTGTGCGAGAATGATTAGTATAACAGAGGGTGGCGTTCAC
AAAAGCACTTCGACACATACCTGAACATATCCCTGCTTGTCTTCTGCACGCGATGCGCTCACGAGGTGGCACAACAATGACTCGGCAGCGCGAACGACCT
TCGCACGCTGGAACACGCGTCGGCGTGCCTCTTCCATCACAAAGCGACGAATAGCAAACTGCAGCTTGGACTCGACGAAAAACCTAATGGGCGACTTAAC
ACTTGCGGCGGAGATCCGAAGGTTCGCTAGGTGCGGGTACTGGTGAAGCAGGAGCAGCGGGTGCGCGTCCTGCTGCGAGTTCAAGAAGCGCACCAAAGAA
GCGACGGACTGCTCCAGAGCCAACGCACCCGTGGAAGAGTTGTCTCCAGCAGATCCCTTCCTCTCTGTTAGCGTGTTCAGCAGCTGCACCATGAGCGTAA
ATGCATCGACCACCGCAGTCGTCGAGTTGAACAGCGCATTCCATCGGCCCCGAGAAGTAAACAGCGATTCTCGTGCAGCTGCGTCAAACTTGCAGCCCGT
GAGCAGGTTCTCGAACTTGAACAAGCTGTCTAGCGTCTCCACGTCCTCCGCATCCGCAGGGGCCTTGGGTGTCTTCTTCTCCGAGATCTGTCTCACCGCT
GCGCTCATGCGCTTGTGCAGACCCTGCAGGTACTGCTCGTTCAGCGGCGTGCTGATCTGAGGGTTGGCAGCAACCTCCGTGGCAAAAAGAGCAGTAGTAA
CATTGCCCTCCTTGGGTTTCACGACCGCCAGCGAGTCCCACAAGTTGTTGCTGTCGCCAAACGCGCCGCCCAACACCTGGTAGCTCGCGCGGAACAGCAG
GATACGGAACACCGACGCCGCGCTGAGGATGGCCAGGTTCTCCAGCACGCTGCTCGTGATCTGGAACGTGACTCTGGACGCGTGCAGCGCGAAGAAGCCG
CTCTCTGTCTCCTGCATCTTTACCTCGTCACCACTGCCGAACAGCCAGCTCAGCGCGCGGCCAGCGACGTACACCAGCACTCCGCGCCTCGCTGCGCGCA
CCACGTCTCTCTGCATGGCCCGCACGAAGGCCGCGCGCGGATCCAGCACGAACGGATCTTGGGCCAAGCTCGTCTCCACCGCCACGAAAGACGCGAAGGC
CACGAGGCCGCCAGCCACTGCGAAGGAGCCGAAGTCCGCCGCCACCTGTGCGCTGGACGCCATGCCGTAGTACAGCGCCAGCTTCCACACGTACGAGTGC
AGCACGCACAGCAGCAGCAGCACGGGTAACTGCGGCTGCTCACGCGCACGCGTCACAGCGTCCACGGCGGCGCACACGGCCGTCTGCAGCCCTCCGCGCG
TGCTGGCGACCGGCTCGGCAGCAGCGCGGCGCGGCGTGGGCAGCAGTGCGAACCGGAGCGTGAGGTGCGCAACTGCAGCAGCCCACAGCACGCCGACGAC
CAGCAGGAACGCCGTGAAACCGGGAAATTgcagcggagagagcagcggcagcgacagcaacagcagtagcggGAAGACGACGGCGCCCAGCGTCGTAAGC
GCCACCGCGCGCAGCGTCTGCTGCAACCGCTGCTGCAGGTGCGGGTAGGGCAGGTCCGAGACGGCGGGAGACGCCGCCGCGCCGCCCGCGTACAGCCGCA
GCAGCGCGTACAGCACCTCGAGCGAGTGCGAGAAGCCCATGATGGTCTTAATGGCGGGGGATCTATGGTGGTGGTACACCGGTACAACACGCTGCAATTG
GTGTTTTGTACATGATTAAATGGTGTAGACCACTGTACGGTATGTGCACCACTGTGAGGCACCACATAAAACATGCGTCTGTCGACGCGCGCGACGTCGC
CGCTCGAACCTAATTGAAGTGCCTGAGGATACTGAGACCATGCAGCTTTGCGCCATCACTTGGCAATTCGGTCGCAAGCGCACGAGGACTCAGCAGAAGC
TTTGGTTCTAGTTGGCATGTGGCGCCGCAGCGGCTCGGCGCTGAGCCAGCGCCTGGCGCTGAGCGAGGAGGTGGCGGAGGCGCTGTACGGGCGCGCGAAA
CGGCCCGTGGTGGCGCTCGAGTCCACCATCATCTCGCACGGCATGCCGTTCCCGCAGAACCTGCAGATGGCGCAGCACGTGGAGGAGGTCGTGCGCGCGC
ACGGGACGTGCCCGGCCACGGTCTGCATTGCCGACGGGGCGCTCAAGGTGGGGCTGGGCGAGCGCGACCTGGCGCAGCTGGCGGAGCTCGGCGCCGGCGC
CAAGAAGTGCTCCACGAGGGACATCGCGGCCGCCGTGACGGACAAGAAGGTGGTAGGCGCCACCACCGTCTCCAGCACAATGTACGTCGGCTATTGACGG
TATGTAGAGGGCGAGATGTGGTTACTGACCGTTGTGGTGCGTTGTGGTGCAGGCGCATTGCCCATGCGGCGGGGATCAAGGTGTTTGTGACCGGAGGCAT
CGGGGGCGTGCACCGCTTCTGCGAGGAGACCATGGGTGGGGTGCACGTGTAGTTGCAGCTCCAGTGATGGGGTTTGTTCGTACTATTGCTGCTGACGGGT
GCGTTGTTTGGTGTCAAGACATCTCGACGGACTTGTTGGAGCTCTCGCGGACGCCGGTGGCAGTGGTGTGCGCCGGCATCAAGTCCATTCTCGACATCCC
GCGCACGTTGGAATTTCTGGAGACTCACGTGCGGTTTGTGAATGAGTGGCGATGTTGAAGAAAAGCGAGACTGATTTTATCCTGTTGATGTGACTTGGTG
CTGCAGAGCGTCCCCGTGATCGGGTACAGGACGGACCAGTTCCCGGCGTTTTTTACGCAGGACAGCGGCGAGAAGGCTCACCTTCGCCGGGATACGCCTC
AGGACATTGCGCGGTTGATCTATGAAAGCGAGACGCTGGAGCTCCCGAACGGCCACATCATTGCCGTCCCAAACCCGAAGCCAGTGCCGACTGAGGTCAT
CAATGAGGCCATTGAGGTTAGTGTCCTCGTCTGATCCGCTTGCGGTGTACCAGTTGCAGCAAGCTAATTGTGTGGGATGTTGTGTATGCATTAGCTCGGT
CTTAAGGAGGTCGTGGAAAAGAATATCCATGGCCAGGCTGTGACGCCCTACCTTTTGAAGCGAGTGAATGAGATCACTCAGGGTGTCTCGCTCACGTCTA
ACATCGACCTGGTCAACAACAATGCCATTGTCGGCAGTCAGGTCAGTATTGCGGTAATGCGGAGCGATACCATTTCATGACTGACTCCATTGTTGCGATT
GGTTGCAGATTGCATGCGCGCTGTTCGACTTGGAAAACGGCGGCGTGGTAGATCCTACTGCCAAAGCGGGCGTTGTATATTCCACTCCAAAGGTTAGTTC
ATCTTCTTTCTCCGGTCGTATTTGCTAGTATGGTCTAACGAAACACCTCTGCTCATGACAGAAATCATCCTCATCAAGATCCAACGACGGTAAACTCGTG
CTGGTTGTCGGCGGCCTAGTCCTAGACATTATCAGCTCGTCTGCGTCACCACTGATCCGTGGCACCTCCAACATCGGAACCATCAAGCAGTCCAGTGGAG
GTGCGATTTCAAACCACAACTTGTGTGAGAGTGATCTCGTGGCTGACTGTGTTTGTTATAGGAGTGGGAAGGAATATTGCTGAGTGTCTGCATCGGCTCA
GGCTGGATCCTATGCTCGTTTCCTCCGTTGGGAATGATGCACCTGGATCTGTCCTCTTGGAGAACCTCAAGAGACTTGGCTTGGATACCAGTGGCATCAC
TGTTTCTGACAAGCTGGCTACAGCAGTGTATTCTGCTGTCCTTGATTCAACTGGAGACATGGATGCTGCTATTGCGGATATGAGCGCGTTCGAGTCGATT
GTATGTGAGTATTACCGGGAATCGAATGAATGTGTGTCTAACCCCATGTCGTTTTTGGCTCACCAGGAGAGCAGCAGCATTTCCGACAAAACGATTGATA
AGGCACAGCTGATCATCGCGGACGGCAACTTGACTCCAAGTACTATCGGAGATCTGTTCAAACGTAGTGCGCGTCTCGGCGTAGATACTTGGTTCGAGCC
CACCTCGGTTCAGAAGGCTCTTCGTGTTGTGGAGGGCGACGGAGTGTCTTCCATGAAGTACATGTCTCCGAACGCTGATGAACTACATGCCATAAGTATG
GCAATTCGGCAAAAGCTTGAGGACGCAGGTGTGAGCTCGGAGACAACTGATGAGCGCTTCCCACTAACCAAGGACTCGGACATTATTCCCAAGGAAGATA
TGACTCGCCTCAAGAATGACCTCATTACAGGTCTGTAACTGCTTGTCATGTTGAAGTTGATAAGCATGCTAGCGCTGCTAACGCCCGCGTATGTTTTTTC
AGCTCTGCTCGCTATGGCGAATGGCGATACCAAGCGACCTAAGCATGTTTTGGTCACTCTCGGTAAGCATGGTGTGCTGGTTGCGTCGATCAATGAATCT
ATTCGTGAGTTGCGGGAGGTCGTGGATGAGTGCGATTTTCCTGTTGAGATTTGGGGAATGCACCACGTCCATGGAGGCCACTCTGTCACGATGGTTCACT
TGCCCGGCGTGGAAATCCCCGTCACGAATAGCACTGGCGCAGGTGACAGTATGGTAGGCGGAACGATCTACGGCTTGCTGGAAGGATACGATATATTCCA
GAGTTGTCACATGGGCATGATCGCCGCTCGTCAAAGTCTTACCTCTGAGCACGCGATTAGCCCCAACTTGGCCCCTCAAGTGTTGTATTCGGCGTCATGA
ACTCGAGTGAATACGCATGGAAGTCAAAGGCAAACGATGATGAGTTGTTGTATTTCATGCAGTAAACGTGCCGTATCCCTCACTAGGTCTTGAATATCAA
CACGGTTTGCCTGTCTTTCATTTCTGTTTGCCATGATGGCACTATCTATTGTTCCTGGAAGTCGCTCGCAAACACACCGATGAGTCGGGCAAGCTCCTTC
TGCAGGCCGCTGCCATTCTTCGCGACAAACGCCTGCACGGCACTCTGCTCGGAGGCGCTGCTGGGCTTCTTGGTCAACCTGCACGAGATCTGTAACAACA
CAAAACGGCGAGATCGACTCAGCACCGAAACAAGAAAGCAACACGATATGCGGCAGAAACATGCAGTAGTCGTACCTCGTAGTCCTCATCGTTCGAGATG
TCGTTCATCTCGTACGAGCCCTTGCAGGTGCTTCCGCCGCTGATCGACACTTCGAAGGGTAGCGTGAAGTTAAAGTCGAACAGGTACCGCTTCTTGCCGC
GCACGACGCAGATGCTGGCATCGCCCGTTATCTTCTCCGGCTCCTTGAGCGTGGCCTGCAGGTTGCCCTCCGAGTAGGTGGCGCCAGTGAACACCTCCTT
CCACTTGTCCTCGGCCCACTTGGTCACCACGCGCTCCTCAAACGTGCCCGCCGTGTTCCACGCCGAGCCGTCATGCTGCGAAGAAGGCGCCTGCAAAAAT
AAAAATATAACACACGAACACAACAACCCCATCAGTCCACTAACCAAAAACAAAAAGAGAAAAAAAAAAAAGATTTTACCTCCGCCGGCTTGGTCTCGAT
CTTCTGAGGTGCGATGTCTCCAATCAGATTCTTCTCCTCCTTGGACAGCTCGCGGTGGAAGTACGGCAGCCCGTTCTTGTAGCCGCGCATGTCCTCCGGC
AGGTCCGGCTCGTCCGCCACGACGACGGACGATGCGCCGGAGCTCTTGGGCTTGCTGCTAGAAGTCGACGCTGACGTCGCCTTCTTCGGCGCTGAAGAAG
AGGAGGAAGCGGACGAGGTGGGGGCCGACGTGGGCGGGCGACGCGGCGGCTCGGGCTTCTTGGGGGGCTCGGGCTTCTTGCAGATGCGCTTGTGGAACTG
CCAGTCGCTGGCCTGGCACTTGCGCGCGCAGTAGACGGCCTTCTTGCACACGCTGCACTTGAGCTTGGCGCCGGGCTTGCTGCAGTTGCGGCAGGCGGCG
TCGGCGGCGGGCGCCACCTTGGCGGGCGTCTCGGCCGCCTTGGACTTGTCCTCGTCCTCCAGGTCGGCGCCGATGTCCTTGAAGCGCGAGTAGTCGTTCA
CGTCCACCTTCACCTCCTGCGTGCGCTCGATGAGCGAGTTGGCGTCGAAGCCGCCGCTGTCGCCGCCCGCAGCCAGCGGCGACGGGTCCCAGCCCACGTT
CAGGCTGGCGGCGCTGGTCGGCGGCACGGAGGACGCCATGGTCAACACGTCACGTCGCGTAGCTCCAAGTCGCTTCTTAAGCATTTAACTTAAGTATTGG
GCTGTTTGGCTGCAGCGGGTGACGTACCCATCGAACTTTCTCGATATTACAGTTTCAGCCAATCATATGCCAACTCAGTAATGCCGGTACACTGTACCAA
TCTCTGTGCTCCAGAATGGCGACGTCCTTGCAGGAGGACGACGAGGGCGTCTTCGAGGCGGCGCTGTCCTTCGTGGACGAGTTCGAGTTCGAATCTGGCG
ACGCCATGTCCTCGCTGAGCGTGTTGTCTCCCCAACGCCGCCAAGAAGTCCCTCCAACGCTCAGTATTGGGCTGGCAATGGACGACGCTGCGCAGCCTCT
GTCCAGGGAGGAGAAGCGCCGCCGCCGCGCCGAGAAGAAGCGGCTGCTGCGCCAGGCCGGCGTCTACAGCGACCCGAACCGCGCGCGCAACGAGCAGACG
CGCGAGATCGCCTTCCTGCGCGAGCAGATGGAGAAGCTGCAGCTCGACCTGCAGGTGCTGCAGGCTCGGCAGACGCAGAAGGGCGGCGTGAGGGCGCTGG
CTCGAGTTACTACAAGGAAACAGAGGCCGAGTGTGTGGCAGGAGCAAGCCGTGAGGCAGCGCCGGAGGAGGGAGCAGGCGGAGTGCGATAACGTGCGGCT
GAGGCTGGCGGTGGAGCGCCAGAAGAAGGTGGCGGACAGCTTGGGCGTCTTGATTCGGAAGCGGACGCGGCAACTGGTGAGATATTATGGCTGTGGAGAG
CTAGAGGAGGGTGAGCGGCTGCCTAACGGTTGGTGGGGCTTGTGTGGTTGGTGGCTGGTAGAAGAACGAGTGCGCGTCGCTGATCAACCAGTGCTGCGTC
AGCCACCCAGCGATAGCTGTGCTGGACTTCTGCGGCGACGTTGAAGAGTTCCGCGGGCTGTTTTACCTTTTGGACGAGGCGTACCGAGGTATGGACGCCG
TTTTTGGGGCGAACGGGTTGGCGACAACGTCCATTCCGATGGGGGACGTACATATGCGTGAAGGCGTGGATGGGAAGTACCTTGAGTTCTCCACGTACAA
GGACC