Description :
From Genome Similarity Track
Location :
Scaffold_66:66902- 68459
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_66-fgenesh-gene-0.6Folate-Biopterin Transporter (FBT) Family

Sequence
1557 bases(100 bases per row)
AGAATGGCGCAATTCGAAGTGGCGAACCACCCAAGATCTTCTCGCGTGAATCGTTTGGCCTTCTagCACAGTACGCTGGCGTCGGGCTCGTGGGGGGCgT
GCTGCCTGGGgTGATCTACCCcATTCTGCAGGGCTACTTGAATGCGGAAGGCACAATCGTGGTCTCTGCCACCGTGCTCGTGCAGCTACCATGGTCGTAC
AAGGTCTTCTTCGGAATCCTTACcGACTGCATGCCGATCTGGGGCTATCGGCGACGGCCATgTAtGCTCCTCGGGTGGGTCATTTGCTGTGCCTTCCTCT
TCCTCATGGCTGGCTTACACGTCCCAGCACCATACTATGGCGAATACAAACTGCGCGgTATTCCTGCTGTCGAGTACACCGACacTCAAAAaGCTCAGAT
CAACTATGACGCCCCCAACGAAGCCGGCAAGTATGTGATCCCCATGATGCtcGCGTCGTTTGGATACTTGTTTtGTGAATtCGCAGCCGATGCTATGGTC
GTGGAATTTGCTCAACGTGAACCGCtCGCCACCCGCGGACGCCTCCAAACGGCTGTGTATGTGGTGAAGACTGCCTTCAACGCCATCGCTGCGATCGCTG
TTGCGTGCGCCTTCAGTGGGTACGAATACGGTGGCAAaTTCGACTTCTCATtCTCGTTTCCctAGATGATGCTCATTCTTGGTTGCTGCTGCGTGCCGCT
TgTGtCGATCACGTGGTTCTTCTTAaCCGAGACGAAGATCACACGCATCCCCTTTGGCGCATACATCAAGTGCTTTTGGGAACTGCTCCAGCAACGGGCC
ATCTACCAGATTGTCGCCTACAAGTTCTTTAGTGGTGTTCTCAACAGCTTCAACATCGTCTCCTCCAGTAACATCAAGCTTTACTGaGTTCACGTCAcGC
CTTTCAACAACAGCATCATGGCCAtcaTCgggcagcTCTTGTATGCAGCCACGCTCGCAATCACGGGCCGGTTCGGACTCAACTGGAACTGGCGCTCCCT
CATCATCGTGACCATGGTCGGAGCTCTCACTGTCGATGCCTTTATGACCATGCTGACGGTTTGgAATGTCGTTCGCAACCAATGGTTCTGGCTCGGTGTG
CCTGTGCTCGAGTACTTCCCCGACAGTATTCGATTCATGGTGGCGACGTACTGCGTTGTGGAACTCGCTGacGAAGGCTACGAAGGTGCTTTGTACGGTC
TTTTGACGGCGACAACCAACCTTTCGACTCCGTTTGGGCGATCCATGGCAAAGATCATCAACGCCAAGTTCAAAGTATGGCTCCAGGATATCATCGATGA
TACGTAcGAGGTGCGTCGAGACGTGACCATCACGATTTGGATCTGCTACGGTATGAAGCTGCTATCTTTGTGTTTTCTACCGCTTCTCCCACGACAAAAA
GCGGAAACACGAGAGTTGCGCCGCACCGGAGGCAAGAGCtaGGTCCcaGGGATGGTCACGATCGTGTACCTCGTgTTTGCAATGGTCTGGTCCACGATGA
TCAATCTTTTCAGTATGTATGACAAGACGAAGTGCTGGAAGATTACAGGTGGctGCG