Description :
From Genome Similarity Track
Location :
Scaffold_1583:669- 3655
Sequence
2986 bases(100 bases per row)
CCCCGTCACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGCTCTAGCGATGTCTTGTTCACAAATGCAGTACCTAGAT
CGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTTTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCA
TTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGA
CCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCGGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGT
CCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTTGATCGTTGGATGCAGT
GAGACAGACCCGACGGTAATCTTTAGGGTCGGAGTCCGAACTGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCT
GGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCACAGCACTTCTT
CAAGGTCATCTTCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTACCAACGTCTCGATGAAACGATCCACGTGTTCCCGCAGTAC
CTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGCCCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCG
TGGTAGTATTGTCGTGCCACCGACACTCCCAATCCATAGTACTGGGTCTGGAAATTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCT
GCCGATACCAGTTCCTAGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTT
GCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGAT
CCACCTGCCCCGGCTGTGGCTGCTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCA
CTGACTCCATCTCCACGTCTCGTGATCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGAGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGC
AGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGA
GCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGACTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCTT
TCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGT
GTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGGTCCATAGTACGCGACCTTTCTCCGGTG
ATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGC
CTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCG
TGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTG
GATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTG
GGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTACCGGATCTTGACTTGCGTCAAG
ATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTTTTTTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCA
AAACTCCATCAATCCGCGGATCTTGTTTCACTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCAT
CTTCTTGGAACTCACGGTGAAATTCCGAGTCACCAAAAGATCCGAGCACGCGCACCATTGTGGTGTAGCGGGATCGGCAAAATCTGCGAGATTGCCGGAT
TCAACTTACCAACTGCGCCCAGACACCGACTAACCGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGG
CGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCCTGAGCGTTTTGGCAAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCT
TCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTAGATCTGGCCGTAGGGTTGCCTTGCGGG
TGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAATGTGGTGTAGCG