Description :
From Genome Similarity Track
Location :
Scaffold_1494:669- 1877
Sequence
1208 bases(100 bases per row)
CAAGCAGCGATCATCGAGCAGCTCCGCGCAGAGAGAATCCGAACAGCGCAAGACGAGGAGAGATGGGTGAGAGATCTGAAGAAGTGGATCACAGGCGAAG
GCGCAGACCTACCGGACGATAGGGCAGAGAAAGCGTCGAAGGCGGCGGATCATTACGAGGTCGTCGACGACCTGCTGTACTACGTGGGAAGTCGGAAGTC
ACGAGAGGCGATCGGTCGAGAGAGCAGCCTTCGACTAGTTCTTCCGACGACGCTGGTGAAGGAAGTGCTCCATCATTATCGCGCGAGTCTAAACGGCGGT
CACCAAGGGGTGAGTCGAACCTACGATCGGGTGAGAAGATGGCTATACTGGAAGGGCCAGTACCAAGACGTTCGTGACTATGTGGCTGCGTGTATCGACT
GCCAATCCGGCAAAGGAGCGCCTCGGATCGTGGTTCCCAGCCCGGGCAATATCGTAGCGACGAGACCATTCCAGGTGATCGGCATGGACCACACACCATC
ACTGCCAAGATCACATCGCGGGAACTCAGAGCTGCTGATCTGGGTGGATCAGCACACAGGCTTCGTGATCGTCAGCGCCACCcGCAGCAGAGAAGCCCAA
GAAGTCGCGGAATCCTACGAGAAGGCTATCTATAGACGATTCGGGGCGAGCGAGATCGTCAGACACGATCGCGAACCGGCGTTTATGTCAGAAGTGTTTT
GGTGGGCTCATCGGGGCACGTAGCAAAGCGACTCTGGCCTATCGCCCACATTCTAGGGTTTACAGTGGAGATCAAGTCTCCAAGCTCAGTGTCAGCGGGC
CAGAGAAGATGTCAACCGACTGTTGCGTGCaGCTATGGAGGAaCGGtGTGATCAAGCCAGTAGCGAGAAgCGAGGAGATGctAaCGCGATCGTCgAaGGT
GCACGAGTGTGGGTTTACGTGAACCAAGTGAGgCCGGGgTATGCCAAGAAGCTCGCCCACCTGTGGCACGGCCCCTTCAGAGTACTGGAGCGCCTTGCCG
ATCACGTGGTACGACTCGAGATTGAAGGAaCCGGTtAtCGTATGTTCCCCGTGGTGCACGAATCTCGCCTGAAGTTGTGGAAGGAGTATAGTAGACAGCC
AACAGGTGAGCTCGAAGTGGCCAGTGAGGATCGtCTCGACTTCGACGAGGCCCTTTTGCCTGAAGACTCATTCGAGCCGAACGAAGACGCCGGTGATTAC
GAGATCGA