Description :
From Genome Similarity Track
Location :
Scaffold_158:66891- 70350
Transcript NameFunction/comments
Physo_143920reverse transcriptase

Sequence
3459 bases(100 bases per row)
TCCAGATTCTTCGGCTTCGCCTCGAGACCGAGTCCTGAGACTCGGTGGCGTAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGG
ATAAGTGCCACTGCTCGCAGACATCCAGCAAGCGTTCGACCTTCTTGCACAGGTCGTCCCACGACGTACCCCCGATGAGGATGTCGTCGATGTACGACCT
CCGTCCCAGAACGGAGTGAATACCTGGCTTCACCGGTTCGCCGTCTTCAAAGACGTCCCGAGTGCTGCCATCCGGGGACAGCTTCATGGACCCGTAGAGC
GCGTTGTCGATCAAGCGTTGGTAAATCTGCGGCGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTGATGAAGGCTGAGGTGAGCCGGGCC
CGGTCTGTCATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAAGTCGTTGACGAGCGGCA
TGGGGTAAATCATCAACCGTATCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATATCGACGCCGTTCTTCTTTATGATCACGACAATGGGCGA
CGCCCACGGCGACTTCGACTTCTGGATCATCCTCGCGCTCAGCAGCCCTTTGATCAAGCCGGCGACCTTCTCTCGAAACTGCGGCGGGATTTTCCGGACG
CGTTGCGCGACGGGTTTTGCGTCGCCCACGTCGATGTCGCAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCGATCAACCACTTCCGTA
GCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCTCGCGGCTTCCTTGGGCGGGAGTCCAGTCGGCATGCCGACCTTCAAGTCCTCGATCTTCACTTC
GGCGGTCAGCGAGAGGTCTGGCAGGACTGCCATCTCAGGCTCAAGATCCTCTACGAAGAGGTCGGACCCCTCGTGGATGAGGACCGCGTCGTCTTCCTCC
TGCTCATCAGGTTTCGCCTCGTCGAAATTCGGCTCGGCGGGGTTTGGTCCGTCGAGTTTTGGCTCAGCGAGTTCCGACTCCGGCGATTCTTCCATCGCAG
CGCTTCCAGCCACAGTCGGAGGAATATCGGGTTCGCTTTCCACCGCCTCCTCGTCCGTATCCGGCTTGTGGTCGTTGGGTGGCAAGTCTACCCCCCTTCC
CTTCGGCGCTTCCGCGACAGCCGCCAACACTGGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTAT
GAGGGGCGATCCGTCATCGGTCCGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCGCGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTACC
GGGTGGAGCCCAGTCGGACGAATCCACGGTTCCGAGGCTGGCCGTCAGACGACGTCCACCACCCAAGCGTTTCATGCGCGTCGAGGGTTATCGCTGCGTC
TCCGATGTTCGTGACACGCAGGTACGTTTTATTTCCGACTCTCCCCTTGACAAAGGTAGTCACCCACGACTCTGCCCGTGTCACCCACAGGAACGGTGCG
TTTCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACGTTGACCGGGTGCATCCGTGCGCCGTATAGCGGTC
TTCGTCCGATCATCTGGATATGCACCTCGTCGGGGAGGCACGCCGTGCCGTCCGCAGTCGATGCGCACTCCAGCGGTCCCCATGAAGTTCATTCCCAGGA
TTGCGTGTTGGCCGACCAAGTCGCCGACCCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATA
TGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTCCGTGTCAATCAGGCAGCCTACCTCACGAGCAAAGGTGGTGTCCAGGATGGACACCTCGGCA
CCTGTGTCGAGCAATAACACAGCAGGCGGTTGTTCAGCTTTCCATGAATGTTGGCCTGCTTGTACCACTTGTGCGGTGCGTAATGTTTCCAGTACCTGCG
TCGCTCTCCTGGTTGCAAGTCGATCTGGTTCACGTACAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCGCGGCGCGCGTTCTTGCGTGGTACG
TTCCAGGTTGGATTCACATGTATTATCATTCAGGGAAGTCGGGCTCTCACGAACCACCTCTCGCGACTTCTTGGTCACATATGCATAGACGGAAACAGGT
CGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCCTAGTTTAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTATTCGGGTCAAACCA
CTGGCGCAATTGGTTGAAGAACTCCTCCATCGGGCATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAAGCATCGCTCCGTCGGGTGC
TGGCCACCACACTTCTGACACGTCCGTCAACAACTTCCAGCAGTCCTCTTCGACATGGCGACGTGAACCACAGTGGCGGCACCGCGGGCGGTCGCGTCCC
GAGCCGTCGGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGCCTGTCCCGCGACGAACAACTTGGCGCGTTCTTCGTCCGCCTCGTCTTGGTCGT
ACTGGCGATCGTCACTGTCGCAACTTTCGCGTTCCGAGTCGTACTCGTCCGACGCGACGTGAATCGTATGCACGGCGCGCGCCGGCTGAGTCGGCGGGGT
CGGCGCCTTTTGGCGGAACTTGTTCGAGCCGAAGAGAGTCTTTTTCTGGTGAACCAATCCACGTTGTCGGGCACGCAGCTTCTGCTCCAGCGCCTCGGAG
TCGGCGACCTCCATCAGCGTGAGACGCGAGGCGAGTTCGGCCTCCTGCGGGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTCTCTTCAGTCG
TGCCCTCGGCGTATGGGATGTTGGCCCTCATGCCCGCGACGTTGAGCCGGTACAAGTGATCCAGAGGGGTCTCGTCGGGGCGCTGAGCCGCATGGTAGTA
GCGACTGGCCATTGACACGCCCTTGCCGCAGTACTGCACCCGGAATTGCTCCATCAGCTCGGTCCATGATTTCTTGACCTTCCTGGGCTACTGGAGATAC
CATTGGCACGCAGGGCCGCTCATTAGATCGCTGAACTGCCCGCACACTTCTTCGCCCGTCATCCCGTCGCGCCGCACGGCGGACTTCAGACCGTTGAGCC
GCAGTCTGGCTTTCTCTTCGCTGGCGTCCCGTCCCGAGAACTCTTTCAGCTCGGAAGATGCTGAGAGGCGTACGCGGGCGAGGGCTACGCCACCGGCTGT
CGCCGTCGAGACGGCGGCCGCGATTCTTGGCACTCCGATGTCCAAGTCGAACAGGTCAT