Description :
From Genome Similarity Track
Location :
Scaffold_6:66888- 71221
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02346NADH-cytochrome b5 reductase, putative
Sappa_CBS223.65SPRG_02347kinesin-like protein
Sappa_CBS223.65SPRG_02348predicted protein

Sequence
4333 bases(100 bases per row)
GCTCATGGAGCCGTTCGGGTAACCCTTGACGATGAGGTCCAAGAAGCCCGCCTGCGTCGGCGCCGACGTCGGCGTATACGGCTTGATGACGTTCTTGCCG
TTCAGCGACGCCTTGGCCATGACGAACGAAGCGACCTTCATGCCGCTCGTGTCCGTCTCGCTCGGGAACTCGAGGCGAACCTTGTGCGTGTTGTGCGTGA
GCTTTTCGTTGCTCAGCACGCGCAACGACCGCCACTCGCCGGGGCTGATGGCATGCTTCTCGCCTTCGGCCGAGGCAACGCCCGAGAAGCCGGCGGCCAT
AAAGGACGCACCGAAGGCAAAGCCCATCTTGGCCGAGTTGGCGGCCGAGTCGGCCGTCAGCATCGAGGCCATCTTGCGCAGCTGGTGCCGGGTCACGCGG
AGGAGCATCATCGTCAAGGGAAAAGAGGATGTTGCAGTCACTATTTCTGTGGTTCAAGGCCCGTGGAACATTTCAGCCAATGGCCTTGGCCCTATTGGCT
TCGAACTTCGATGTATTTACTGGACCCCACCCCCCGGGGCATGATCCGGTTACACACCCGTGCACTGTGATAGGGCAGCACCGAACCGGCTTTTTATTTG
CGCGCATTGGCTGCTTGCCCTTGACGGCAAGGGCACATCGCCGTCCGACAACCGCGGTGATATCGGTGCCCGCACAGGGAGGGCGAAAATCACTTCAAGA
TATGTATCGTATCAGGTGGGCCAGTGCGTGTTACATAGGGGGTCCCTCTGTTTGCCGCTGGGAATAGTGAGGAATTCCGGACGGGGTGGCCAAATACACT
GCTTCGCACAATTTCTTGGGTACCAGGGAGGGCCCAAAACACCCACCTGCAGGTTCGATCCCGGAAAGCCATCGAATTTCGAAGCACGTCACGGCCAGTA
TCCGGATACCGGAATCCAATCTTCGACAAGATCCGAGCGAAACCACCGCAGCGACGTCATGTGGCGGGCGCGGGAGAAGACGTCCGTCTCGGCGTCGACA
GCGAGCTCGTCGATGAGCGGGCTCGGCGGCGCCCATGTGGCGGCAAGTGTCCAGAGCAACGGCCGCCGTCCGAGCAACCCGCGGGTGACGCCCACCAAGA
TCGGCAAGCCCGCGGTCAAGACCAAGCCGACGACGCAAGCGATCGCCGAGGTACGTCGCCGTCGCTGCCGACGAGGTCCTGATCATCGACAACTAGATTG
AGAAGAACCGCGAGGACCGGCGCAAGGCCATGGCGCTCGTGAAGAAGGAGCGCGAGCAAGAGTCGCTCAACAACGAGCGCAACGGAACGCCGGGCGACGT
GGACTTTCAGCGCATGATCAAGCAGTTCCGCGAACAAGACCATCAGGAGCTCAGTCACACGTCCAAGGGCGAAATGAAGATCACGATCTGCGTGCGGAAG
CGCCCGGTCAACAAGCGCGAGATCCGCGTCCGGGACTACGACTGCATCACGTGTTGGCACCCCAAGGTCCACCAAGAGCGACGTTGCACTTTCTACAAAC
ACGCACATTAGGTCATCATCCACGACTGCAAGCTCAAGGTCGACGGTATCACCAAGTACCTCGACAGCAACGCGTTTGCGTTCGACCATAGCTTTGACGA
GCACACGTCGAACGCGACCGTGTACAAGTACACGGCGCAGCCGCTGATCCAGTTCGTCTTCAACGAAGGGGGGCGCGCGACCGTCTTTGCGTACGGCCAG
ACCGGCAGCGGCAAGACGTTCACGATGGAGGGCATCCAGACGCAGGCAGCAAATGACCTTTTCGCCCAGCTCGACAAGTGGCGCGACACCACGTACGCTG
CGACGGTCCATAGGCGTGAGGCAAGATGTGGCATGTAGCGGCCAAACGCTCGAGCTCTGGATGAGCTTTTTCGAGATCTACGGCGGCCAGTGCCAGGACC
TCTTGCGCCAGAAGCGACTCACGATCCGCGAAGACGGCAACGGTGAGGTTCAGATCGTCGACTTGGACGAAGTGCGCATCCACTCGGAGGCCGAGCTGCT
CCAAACCATGCAGCGCGGTAGGCGCGTCTTTTCGCTTGCGGTGAATGTATCTTGTGCATGGATGTAGGCAACGCCTTGCGCACGACGCATGCCACGGAAA
TGAACGACCAGTCGTCGCGCTCGCACAGCATTTGCCAGCTCCATATTCGAGAAGCCGGCTCGATGAAGCTGCACGGTGCCGTCGGCCTTGGAGGAGCCAA
TCTAACGCTATGTAGGCAAGCTGTCGCTCATTGACCTCGCGGGCAGCGAGCGTGGCGCCGACACCAAGAGCCACAACCGCCAACGGCGCATGGAGTCGTC
CGAGATCAACAAGAGTCTACTCGCACTCAAAGAGTGCTTTCGGTAAAGTACCTCGCTTGCGACGCTTCAGTCCCTCACGACAGTGTGCACAGTGCGCTCG
ACAGCGGCGGGCGCGGCGCCCACATCCCTTTCCGAGCGAGCAAGCTCACGCAGGTGCTCAAAGACTCGTTTGTGAACGCCAAGGCCCGGTAGCCTTCTCT
TCGTCTCGACCACCGATACAAATGTACCTTTAGCACGGTCATGATTGCGGCCGTCTCGCCCTGCGCGTCGTCGGCCGACCACACGATCAATACGCTCCGG
TACGCAGACCGGGTCAAGGAAAAGACGGTTGTGCCCGACGACGGCTATGCAGACCCGCTGCACGTCCACGTCAAGCGTACGCGTCATCGTTGTCCTCCGA
GATTGGCGATTGACGCGTCTTTAGATCTGACGCGGAAGCAGCCCCGAGAAACCACCGCCGCCGCCGCCACCACCGGGCAACTCGCTCGCAGATCTCATGT
CGGAAGCGGTGTCGCGCAACTTGACCGATATGACCTTGTCCGACGACGATGACGAGCTGCACGACGACGACGCGTCGACGTACTCGGATGCTGATCACAT
CGATTATGTCGACCCGCGCGACTCGACGTCGAGCCAAGACGACATCAAGATGCTCCACAGCGCGCTCCGCAACCAGACGGCCGACGGTACGGAGGTGGTT
GATATATTGATACTACGTCTGTGCGTGACGCAGGGGCTGTCGACGACGAAGACCACTCGCTCGAAGACCTCCATGAAGTGGTGTGAAGCTCGTCGCTCTT
TAACACGTGTCTGACGTTGAAGTAGGTGCAGACGCTGTACGAAGAGCAAGAGAATTTGCTGAGCAGTCACATGACGGCGATCCAGGTCCACCTGCTCGTC
AGGCGAGCGTGAACCGGATGCGAACGTTCCTGCGTAGGAAAATGCAGAGCTCCTCACGGAAGAGGGCATGCTCCTCTCGGACGTCCAAGGCGAAGCGGTT
GTCGACTATGACATCGACCAGTACGCCCAGCGACTCGACGAGGTAGACGTAATGACGGGTGCTCCGACTTGAACCGAATGGTGCATCTAGATCCTGGCCA
AGAAAGAAGCGACGATCCGTAAGCTGCGCTTGCAGTTGTCGCAGTTTAGGAAGCGCTGCCAGGAGGAAGAGGCGGCCGCCAAGCGCGTGGCCCAAGTGCC
CTTTTACTAATTTGAGCTCCATGTTCAAGCGAAAAAGGTGTGTGTGTTTAAAGAGCGTATCGAAAGGCGGTACTTGCTTACTCTTGCTTGGCTTCCGTCT
CGAGCTGCTTGTCGACGAGCTTCTTGGCGATGGCAGCCGTGGCGTCCTTGGTGGCGTCCTTGACGACGCCGCTAATGTCGGCGATGACCGAGCCCGAGTT
GGACTTGATGTTGTCAATGGCCGCGTCAATGTTGGCCTCGTGCGACTTGAGGAAGGGCTGGAGGAAGTGGTTGAAGATGAAGGTGGCGCCCTGCGTCGAG
GGGAGGAAGAGCCAGACGAGGAAGCCGAGCTTGAAGGCGTAGTAAAAGGGCACCCAGAAGAGGAGGTAGTCGACAAACACTTCGACGATCTCAAAGCAGC
AGTAGACGACCCAGTACGTGAGCCACTGGACGTCGTCGTTCTTCGAGTCCGACTCGATGGCCTTGAAGGACGCATACGCCGGGTAGACAAAGCCGACGAG
GTTGCAGAGGAGGCCGGCGCCAAAGCCGACGAGCACGACGAGGAGGAGGAGCGCGACGCCGGCGACCGTGAGGTAGAGCTTGTCGACGCCCGTCTGCGCC
TCGAGCTGGACGAGGATCGGGTACTTGTTGAGCTCGGCCTTGGCCTTCTCGAGCTGCGCGTTCACTTGGTCCATCTTGGTTGACTGCAAATTCCAAAGTG
AAAACTGAGGCGCTGCTTCTTTCATCCGGATAAACATGGAAATATTTTTAGAACCCGCGCGCACGGCTAGTCGCACGCCACTCTGATGGTTTTGTCCATC
GCCGCCTTGCAGTGCGGCGGAATGCAAACCTAA