Description :
From Genome Similarity Track
Location :
Scaffold_958:6688- 10511
Transcript NameFunction/comments
Phypl_g11815hypothetical protein

Sequence
3823 bases(100 bases per row)
ACTCCTTCCACTTTCGAGTCTGTTCTGCCGACCGGGCccgcttggccttcttgtgAAGCTCTTTCGCGCAGGCTTGAGCGTAGCTTTAGTCCCGCTGGAA
TTTTCTCCTCCACTCATAAGCTGTCCGTTCAGGGAGACTGGACGGTTTCGGTCCCATCATGGCCGAGACGGTACTTTTGGCGTCCCAGCCGTGAACCAGA
TAAAATGAGGTATCCAGTCGGGTTGCATCGAATGAGGTATACAACGCGAGCGTCAGCCTTTCAGCGTGTTCATCCCAATCGCTTTGGTCGGCTTCGGCCA
CATACGCCCGAACACTTCGGACGACGGTCTGAACGGAACGCTCCTGCTGGCCATTCGTTTGAGGTTGATAAACGACGATGGCTCACTGCCGACTTTCCAA
TAGCTCTCGGAAATGGGTGAAGACTTTACTCATGAAGCGAGGGTCTTGGTTGTGACGAAGCATTGCACTTGCCCCAAACCTCCTGAAAACGCATTCTTCA
TACGCTTCAGCCACATCCTGCGCCTTTGTCGAACACATGGGTTTACACATCACAAAACCGGAAAAAAGCATCTTGGACGAGAAGTAAAAACGTGATTCCA
CGTTCAGACATCGGAAGATTTGTCACGAAATTCATTGAGACAACCTCAAACGGACGTCTAGGCTCGATGTTTCCGGGTGATGGTCCAGGATTGGGAGGTC
GCCCTTTGTCACTCGCACAGCCCACGTATTCCTTAACATATGTCTCGATATCAGCGTACATGACATGCCAGTAGAACTGTGACCGGAGCTTCTCGTGCGT
CCGTGTTATCCCTTATGTCCTCCCTGAAAATCCTCGTGGGCATAATACAACATGTCTGAACGGATTGCCTCCGGAACGACCAGTCTGACATGTCCCTCGG
TTGGTCTCTGGTTGAACGGCTCAAACGGTAAAGCACATCTCGGACATCCAAAGCAAACAACTCCGCTTCTTTCGAGAGCTTCCGGATCTGGGCGTGCGAG
AAGTCCCCGAAAGCTCCTTTCAGAACCTCCTTGAGGCTTACTAGGTGCGGGTCCGCATCCTGATGAGCCTTGATTCGTCTCCATCTTTCGGCTTGACATT
CACCTGGACTCATTGAGATATTCATATCGGATTCTCCTTGGGTGGCCTGTCCACGAGTCACTGCGGCCATTACCCTTACGGCCACTGGCAGAGGTTCCGA
TTGAGGGTCTGGGCGGAGCAATTTTGAAACTTCGGACGGAGGATCTTGGGTCTGTTCGTGGTCGGAGACTTCGTTCAGAACCACTACAGGCTTCATCAAC
TTTTCTGCGATCTTCGAGACTTGTTCCAGGTGGGTCAATTCAGCCGGGTCGTCAACTGTCCAGGACTTCGAGAGTGTCAGCGTCTTAGATGTGATATAGT
CAGCAGCCTGATTATACTCTCGCTCGACATGCACCAACCGGACAGACTTGAACCTCACGTTCAAAGTCTCATATTCCGACAGACGTCGCTGCAACTTCGG
CTGGTTACAATTGATCAGGTCTTGTACTTATTGAATCACAATCCGAGAGTCTCCGACGACAACTATGTCCGAAATGCCACATTCGGACACTACGTCCAGC
CCTTTGAGTAGACCATGGTACTCGGCATAGTTGACCGTAACGTCTTCCAGGATGAAACCACGTGCGGTCAGAATGTGCCAACCCGGGAGTCTCCAAACGA
TACATCCACAGCTTCCCTGGCGCGTAGAGGTCTTCGCAGCCCCATCGAAACTCAAGACGTGTCCGACAAAGCTTTCTTCCAGTATCTCCACGCTAATGAC
CGGTGGCGCCTTGATTCGCCCGTTGGCCGGGATCAACTCTTCTGCGACCTCGTCCAGATGTTTGCGTGGCGTGACGCTTGCACCTAGAATAGCTGCCAAg
ccgtcttcatctcgctgGACTTTGTGCACTTCCAGGTTCCACTAAGACAGAGTAACTCCCCACCGGACATGTCGGCCATTAGCTGTTTTGGACTTCAGCA
GCCAACTCAGGACGGAGTTTCGAGTATAGACCTTGATCGGACAGTTTTAAACGAGAGTTCGGAATACTTCTAGAACTCTCATCACCGCCACTACCTCTTT
CTCAGCCACGTGATATCGGACTTCGGATTCGTTCAGGACTCATCATATTTTTGACTGAGAACAGCACAGGCTGTCCATCGATTGACATGCGGTATAATCA
CAAAGGGCCTGGTCCGGTCGGGATGTCTCAATAGCGGAGTCGAAACGATCTTTCGCTTGAGGATCTCGAACAAGGCTTTGGCCTTGGACAAGTTCCGTCC
GGACTTCACTTGGTCATCGGTCAACTCATATAGGACTGCAGCCACAACTGGGAAATCTTCAATAAACTTATGATAGTATTTGAGACTTCCCAGGAATGAC
TGTACCCCTTTGAGAGTGGTCTGGAACGGGAGACTCTGGATGCTCTTCGCAATCTTGGGCGTGGCTCTTAGTCCTTCCGCACTGATTTCGTGAGAAAGAT
ACTGGATCGACAGTTTCCCAAACTCACTCTTCGGAAGACTGACTGAAATGTTCCCGTACCTCAGACGGAACAACAAGGAATTCAAGTCGTCGCAAAGTTG
GTCCCAAGTGGGCGCCCCATGGGCAATGTCGTCTATGTGCGAACTTCGTCCGAGCACAAGTCCCATCTGGGATGGCGTCGGAATGTTGCGCTTGAACGCC
GTCATCGTGTCTGTCAGAATGGAGACCTGTTGTTCAGACTCCTCACGTTCAGACTCACTCTTGTCAAATGGGTCCAATCCGAGAAATTCCAACACGTCCa
gatccaccagcttctcctcctccgaaGGCAGACGAACGAAACCCCAGAGACAATTATTAATGACAGCTTGATATACGAGTGGCGCATTCTTCAGTCCGAA
CGGCATGCGTACCCACTGGAAATGTCCAAACGGGCACACGAAAGCTGAGATAAGCTTCGCTCGTTCGGTCATCTTAATAGCCCAGAAGCCACTCGCCATG
TCCAGACTCATAAACCACATCGCACTTTCGAACCCGATCAGTAAGTCGTCAATCAACGGGGTAGGGTAGTTGGACAGCACGACAAAACCATTCACAATGC
GGTAATCGATGCACATCCGAATGTCCAtcccgttcttcttcagaaCTATTATGATTGGGGACGCCTAAGGGGAATCCGAAAGCTCGATCAATCCAGTCTC
TAAAATTTTCTTCAACAACTCGTAAACCATCATCGCGAGGTGTGGTGCAATAGACCTAGGTCAATGAGCCACTAGTCTGCCATCACCCACGTCCAGATCA
CACACTACTCCTCGGGAGCTGTGTTGCCATCACCTAGAAAAGTCCTGCGAGGACATTCCAAGATTTTGCGTAACTTCCGTTCCTCAGTTGGAGTCGTCCG
GTCGGTATCACCAATATCAGCCTTCGAGATGTCACATCTGGGGCTGAGATCAGTCAGCTCAGGGAGCATGGCCAATTCGACTCTCAGCTGGGCCATCCGT
TCACTTCCCTCATGCATGTACACACCGGGTTCGAACTCGAGATCTTCCAAGTTGGCCCGCATACAACGAGCGTATTCCCCTTCCAGCTTTTACAGGTGTA
CTAAGGAATGCTTCGGTTGGAAGGTCCATCTCATCGCCGTCCCAATCTTGAACCGGCAACTCAGGACGGGTCAGCTCAGGTCCAGACAAAGTTGCAGCGT
TGTAGTCATCATCTTCCTCCATGTCGGTTCCGGTCGGTAGCAGCGTGATCACCTCTTCTTGAATCAAATCGGTCTGAGTGCCAACGGTCTTCGCCCTCGG
CGCTTGACTAGCGGACTCTGATC