Description :
From Genome Similarity Track
Location :
Scaffold_97:66872- 72644
Transcript NameFunction/comments
Phyca_LT1534511758ankyrin repeat domain-containing protein 50
Phyca_LT1534130730aspartyl protease family A01B, putative
Phyca_LT1534531142pepsin-like aspartic protease A1

Sequence
5772 bases(100 bases per row)
ttcaccagaggaagactgcatattctatgatgtggaagaccaaaggctgcgataaatatcgccaccttacaagctgtgcttcttctctaaatggctttgt
caaagctgcaaccatccaccaccattgctcgtttatccagatcacagcagtctctgatgctgatgctgacgctgacgacgatgtaattctccaaggcaca
gtcactcccaactgcctcaatgccaacacgttcgcgtacaccacgaggcggcatttctcgcgctctgctggtgggaaatgccgatgaaaagctggtctcc
agaccacagcccaatcctgcgacagcatccatcgcacctcaggacgaatccaaaaggcctcttccagcttctgccaggtttcgtttgctgccaaacaagg
cagtaagttagaacaagatctgcatccacataaagcctagcaacagctctctctcacgtatcgttgcacgagaagcccccgcgttcagaagcaaggccac
cagcgagttgttcttgcgtgtcagtgccagtgtcaacgccgaagaacccatcctgaaacattaacaacaaaatatttaacctagttgccagcataagctt
ctccaacaattaactcgtagatctagtaacgtacatcgtggttgcgttcaaatctacaccgtcctcgctcaaaagccttcgcacgattgccatccgactg
tgtgccacagcgtaaagcaacgcggtccacttctctcccatcatcacattcacgtcacctctcgcagagagccaagcattgacgccgtccaggtctccat
ccgctgctgcatccaggaatgcgcgctcacagctcttcttcataccggtgctattgataccggttcaaatgaaatgtaagtgtcactgaagcgaggttta
gagcaggtagagcacttcaacatgacctgtatctacatgtattgttttcgcctacttttaacgtgttccctgcgctctgcccgtaacgggggggcttcta
actccttcttcctcttcgtgaagctcgtcgtcgtcaggtgagccgatagtaaacttcggtgatggacctttcctacctgctcgagatcgaggagataaag
gatttccaggcggagacgttggcgacagacttccagtgtcgatctccactattgtatccatatgcgcgcgcgaagtctctgttgcctccggaatacgaga
ccacgtacgagttcgccacttagtccaaactatgacgccaagtgcaaggcccactagcgagatgagaattacttctgcgataaaagcaccgaatttgggg
cttgaccgcttttccactgtgtctccggatgagccggtggtcacgtcaacacttcctgctgccaatgctgttgctgttgtgttcgattcagcagttgaat
ggttgttgggactgatggaggaagtgtttgccactgctgcaggtgttgattgtccatcagtaactggagcctcggtcgcagaatttggcttttcggtgat
atcggaggcgattggcgatggggttgtagagttggtataacttttgcctgcacaagatattctgtcagtcaaattccgtttaaatactataatttgacgg
aggacgcaccacaatccgactcagcgaagcccacgcggtgattttccatatcaaagatcacgtcgaagccgatcatggtgctcgctcccaatactgtgcg
tcattgagacagttagatggttcagaagtaaaataacgacaaactaagcttacctccgccactgcgctcgctgaagtgaaagttgccatagtaaattcca
gcattgtcggagggagtaagatatcgcgaaccaggaatattcaattgaacatcatcggtaccatctcctttcatccccgacaatataatagaaatcgtcg
ggagagctgctaactcgtcgtcggtgagtttcatgcgtttctcgctatactcttgtcctgcagcatcccggaatgctttcataaagttgcgacttccttt
ggcgtcgaaaaaagtgtcggttgtaccgctatcaacaatcactcctctgccagaattgatggtccccgcgtcaataccaagcgacacgccgttcatccga
atgtccttcacatgaacaggataataggcggagttatcgttcagtagcggcgtgtagcccacatcgctcgtgtgatgactgtaatccactccaccaaaga
caacctcgcccccatcttctgcgaagcacaaagtgaagagattatgcgtcacacgtcctgcactaagcatgtaagacataactgtcgagcgatgcctccc
aagacccattatgccattctccttctgcgtgatgaagagaccagtctctttggtctgacagccaagaggaaagcgaaagccaaatgtcttcagcactcct
tccatttcatcgcttggcgtcgagaaacctcccacccacaccaactcgtcaaccacaacagcttgccacatgctgccttccatatagctctgttgattca
caataccatcattaatgaggaacttgttagtaccaaattcaaatagaagcatatctattgcaaaaccatacctgcgagatcatgcagcgattattttcac
atgaccggcaagaatcgaagtcgtgacaacctagatacttggcagtcgtcgacttggacacgtcaaaaagcgggtcggtgtgtgtgccgcagccattgca
cgtactgcacggcagagctgtcaggtggctacctgtgtctaatatcactgacgctcgttgtgctgggatacccaagtaaatctcagcataatgtgtgctg
caaagcaaaaagcgccacatacctcgtcaattcctatgatccacatctactcactgggctgtacacgcacccgtagcccacacccaatggagcttcacta
agagccaacgcaatgttcctatcaccagtaactgcctccccttgggctctccgtcgacttcgagcttgttgatgagccagtcggtgggacagatccgacc
tcgactgctgcttgtggagatggattttcatgaaattctcctcgccagcggctgcagcacatacttggtaacatactaatactgcaagaacaaccacaga
agcccaccgagctcctgggcttgcgtgtcgagccgtcatagcggcgatgctttatctcagactgggggcattgttgcaaaagttacctcgtctattttta
gccaattgaaaggataatgttattttcggatatggctacaatcgaaacgattgtacccgtatcggaacgattgtacccttaaccgtactttttgacatac
atgtaacatgctggtgtcgggtatctttatttactgggcattggcgaaatacatgatccgttctgtgctactcaaagccgctccaaagtgcggttgtcca
ccttggtctcctgcagagatttccggtcaaagacttcgtcctcctcgtcactgctgctttgatcgtcatcatcgtcgtcctggtcaagtcgctggtgctt
cgatgaaggcgccgatgattgtttcttgtcgttgcgaacaacaccgaactcttcctcatcatcatcgtcctcatcctcctcatctcccttcacccggctc
caaagctgctccttgccagtcttttgtttccgtcgacttactgaaatcagcatcatcaccaaaaagccaacgaccaagacagcaccaacgattgtcagca
ccattggatgggcgcctgaggactccttctccttcaagttctggtctccagtagctgctgaggaggactgtgtagttgtcgtggcttcgtctgacagcgg
ctgaatgatcgggtcagtagtcgaagcagcattcagtgctgaagcgttcactgtcacctctgtcgcagcaggctcagaaattaccgtggcggtgggctcg
ggagttgattccacttctgatgcagccgtcgcaactggttctgaatatgtgggctgcggcgttctccaaacgaccacggttggttcggtcggttcggacg
tcgtagcagaagccggtgctactgtgtccactactgccggtgcagcggtcggttcggacggcgcagcagtagttggcactaccgtattcgttgctgtcgg
tgtagcactcggagcggccgcgtttgtagctttaggaacggcgttgttctcctttacttgagatccacttgtaggactcgtagcacccttatgaatggac
gggggcgccgtcgcattggcacctccttggaaagcgcagtcggcgtccacaaagcctacgcgctgattgccaagatcaaagatcacgtcacggttcatca
tcaggttggctccaataacaccgccagagttctcagacaggtaaatgcctccacagtaagcaccatttgactcgagcagatactgctcaggtggcacatc
tagaatcacttcagcattttcgtctccgtaagcttccatcacgagctggatagtgggtagagacgccagatcctcgttcgtaaagcccttgcaagttgag
ccaacctgatagtcgcgtcccgtaacttccttaaacacctgcaaaaattccgtcttcagcgctcgtgggagatatgagtcggtagttccactgtccacaa
tgtagtgaccgcggctgtatgcctcctccttagcgttaatggacttgccaccaatgcgaatgtccttcatgtggacattgtagaagtgactggtgcaaaa
atttagttagtataaacagcaagatcaatcatatccctgtacaatccttacccagcagagcggtcggaaattactttcgcgtacgatatctcaccccgat
gagctgttttgtgcgggtgtccgacagacatagtgccaccgttgtcggtaaagcagagcgagaacagattgctggagatcttgttctcacggtgtagctt
cgctacaatgtggttctcagtgttggacagccccatgatgccatccgctacctgcgtgacaaacaatccagtctccgagctctgacagccaaactggaag
tgcgttccgtagcggttgcgcatgtcctcgtcctggaaactggactcccctcccaaatacacgatgtcttcaaccacagaggccttccagctgcttcctt
ccatgtacgactgggaaataccgcaagtgtccgcttgctgcttgcactccctgcactggaaaaacgacttctgcgcacaggttacatgaatcaatgtaga
cgagttgtcggcctggaacggttgatccgtgtgtgaaccacagccgtcacaccctgaacacgggaacgccatcaatccgcttcctgtatccgcaatcact
gaggctcgctgaggcggagtaccagcatatacccacgtgtagtgcgttctgtatcagtcacaatgtcatcagaactcaattttaaactactgtcgctgtg
tatcaggtcgtacccgagtcctaaatgcagcggaacgagttccggcgcgtcctcttcaatgttcagacgtcttgcgtatctctccgggtggatatcatgc
ttgggcagtcgatgcagctgcatggtcatgccagtctcttgttctgcctttgtcaatgccgagagcatcgaactgatcgccagaatcaccggaaagccag
cgatcactcgcaccattcttactaacgtgttgagcgtcttcctgatgagaaaactacgctgtggggagtgctagaacactggcaaatgctgctgggcttg
aggaagagagctgtcgatcgatgggagagcaccttggcacgtggcagctttttagtcccttttgaaatgtaa