Description :
From Genome Similarity Track
Location :
Scaffold_3:668662- 674370
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01378aldehyde dehydrogenase
Phypa_INRA-310PPTG_01379hypothetical protein
Phypa_INRA-310PPTG_01380hypothetical protein
Phypa_INRA-310PPTG_01381hypothetical protein

Sequence
5708 bases(100 bases per row)
GAGGTGTCAAGGATAGCGGCATGGGGTGAGCTGTTCAAAATTATGGTTTAGCAGGATTAATACGCTAAAGCTTTTTACCGGTGACTGTTGTACTGCAGGA
GAGAGAATGGACTGGAGGCGTATCGTTCGTACTCGCAGATCAAAAGCGTTATCGCTGGCTTTGGCAACGAGAAGTTTGACTGGTTTGTCGACGATACGGT
TCGGTATGGCTAATTGCACGGCATCTGCATCGACATATCAGCTAAGTGGCTACACCTTGGAGCAAAATGAACATTCAACACGAAATAAGACCACTTAATG
CAGCAAAAGTCAGTCCAGGTCGCTTAGGAGCTGCTACCTCACCTGCATTTTTCGAGCAAGGTGAAGCACTCTATTCCAGTATTAATTTACTGACCAGCCG
ACTCGAGTGGGTGTTTCTTCTGCTGAACGATGCGGAAGAAAGCCGCCACACTCTCCGATGCCCTACAAAGAAAAAAGCACCAAGTACGCGAGCGTTAATA
GACGTCCTGCCTTGAAGCATTATCACTGCAGCACATACCTCTGGCATGCCTCTGAACATGCGAAATATTGCTCTTCTGACAGCAAACCTGGACGAAAAGA
ACAACAAGATTTGTCAGAAAGGTGTCACTTCAGTTCAAATTTGTACTGACTGCACTTACCGTTGCTGATGCAGGTCAAGACTCCGTCACTCGTGCTAGAT
CGCGCGGTGGTGACCCATGAAACAGCTTCCTGTAGGACATTTAACAATCAGCGTGAGATCCTCGTACTCAACGCTGGATATGCAATTATGATACCTCTTC
TTCAGCGGATGTCGGGTCCAGGTACAAGTTGCCGTCATCGAAAATGCTGCACGAGGTCGCCGTGACGACCGAAATCATGGGAACGCCAGCGTCCATCAGC
GCCAAACTCACCGCATTGATTGCAACTGCAAGAAGGTGCTGAAACCAAACGACAAGATCACCAATCCAAAGGTTAAGGATAACTAACCAGCTCAACGCCA
GGTTTTTTCACCAACGCAACTTCACACCCCAATAGCAATCATCACATGCAACTAATAAAAAATAGTGGAGAGGATATAGAGCCATTGTCTTCGATCACTT
GCACCACGATGCTGATAACGGCGCGCGGAAAGTTGTCGGTGAGCACAACTGGTGTGAAGGTCTCTCGGATAATCTGCTCGTATTCCTTCTCCTTAGAGGC
TGTAAACATCAACACAATCATCACCAGTAGCATAAGTCATTCCACCATACTGATAATTTGCTGAATCCATTGGCACGCACTCATGATGCCCTTCTCGAGC
TTGAAGCACACGTCCAATGTAGCCTTGTCCGTCTTCTCAGCGCGCCAATTGCGCGCCTGACCGGGGCCATATACCGCCGCTAGCACGGTACTGCTACCGT
GCGACATACGAGCAGAGCCATCAGCGCGAAATAATGCTCCCTGTTCGGACGCAAACGGCCGCAGCTCGTTGCCGGCACGGCCATCCTGACGCTGCAGTGT
CGTCGCCACCATTGCTTGTTAGATTATTGAGCTTGGCTACATTCGTATTTGTTGGTACCCTGTACCACTGCCCGTACTTAGCACAATCTCCCACAGTACG
TCACCACACCTGATTTCCTCGTCATGGCATGGGGAGCGCCACCTCAACCTGCGGCCCCAACAGCCCCTGCGCCCATGACAGCTAACAATGCTATCTTTCT
AATTCGTAAGCTTGTACATAAACCAATTTTTATATTCTATCTCGCTCTAGAACCCAAGTTACAGCGCTCTAAATGTTTCTACTTGCAGTGTTCGGGATGT
TCCTCATGGCAACGCTATTACCCGTTCTTGTGGCCACACTCTTCCGTTTTGTCGCTCTCGTGACTGTTATCCTCTTAGCCGCTGCAGTCACCAACCCATC
GGACCATTCCTTCGCTCTATGGATCAGTCAGCAGACAGAGCCATCAGATCTCGTGCCGGACACGTCGCTGGGCGTGTCCAAGTGGTTCTCAGCCATGTAC
CAGACAGCTAAATCTCTAGTTCGCAATGAGCCACTAACCTGGCGTTTCCACAACGCACTGGTCTTCAGTGTCGTCCATGTTCCGTCGAGAGAACGTTACG
CCTTTGGCATCTTCGGGACATGGCGCTGGGCTGACGAATCTGGGGATTACATCAAGGCTCTTTGTCGAGCGCCGTGGGTGCTGAAGATCTCGAGAGGAGG
AACCATGTCGGGTATTGACAAGTACCTTGTGAACGGGTCAGGATCCGGAACTGAGTCAGGATCCGGATCACTCAGACGGAGACGAGTACCCGAGTCTACA
GGGTTCAAAGAGGTGGAGACAGAGTCGCATCGGGAGATCAGAGCCAAGGCCTTACAGTGCAAAGTGAGGAAGGACTGGAAGAAAGCAGCGGCGTTCTTCT
TAGAGGCTGCTAAGGCGGCTAGTACAGTGGTGATTCGAGGGAACTATGAGCTGGAAGCAGCATGGTGCACATTGGAGGAAGTGGATACGTACCCGGCAGA
ACAGAGTGAGCTAGTGAAAAAGATTCGCGCCGTATGCGATGAATTGGCGTCGGCTGGATACTTTGATGAAGCTGCACGTGGACTGTCCGAGTTGGCGTTG
AGGCTGAAGCGTAGATTTCCAGCGGATTGCAAGGCCACAGCGTTGGCGAAGCAGGTGGCGGAGTTGTATGTACAGGCGAAGAATATTGCGGAGGCTGGCG
GCAGTGTGCACAGCGCTGCAGAGTATGGACTATGGGCTGCGCGTGCATATGCCGAAGCGAGCTTGTGGTCGCTTGCCGAGGGTTGCTTCGAAGCAGTTGG
TGATATTCGACGCGGCAATGGACAGTACGATCTCGCGAACGAAGCGTATGGCAATGCTGTTCTCTGTCGTCTCGGTCAGCTTGATATCGCCGGGGCGGAG
GAGATGCTCAACCGATTCACAGAGCACATGGGCGAAAGCCACCGATCGAGTGATATGGACTTTTTCCTGTCAAGCTTGCTGAAGGCGTGCAACAAGTGGT
CTCCACAGATTCTCGAGACGGCGTCGAAGCGCTACGATTCGTCGCATCGACTCGCGCCGTGGCAGGTAAACTTTCTGCTGTAGTTATATAGAATGAGTAC
TTGGTTTAACCACTTTGTTGTTGTTTCGGTAGCGTAAATGCCTAGCTAATTTGGAGGAAAAGATGAACAACGCTGACTTGCGGTAAATGGAGACGGTGTG
TGCGAGCAGTAAATGAATTGGATGACTAGACATAACGACCCTGGCCGCTTTATTCTGAGAATCTGACTGCTTGTCAAGGATTTCGCTTATTTCCTGACTT
TGCTAAATAGGTCGGGTACTCTGTATGTGACTCTTGGTGACTGGAAAAAAACGGTAGGAAACGCTGATTGCTGCAAAAATGCACTTGGTGCGCTTCCAGG
CGTAATAAGTCTCCCATGGATCCAGAGCTTAAGCGGCGTCCTCTGCTCTTTGACGTCCGGCCAGCTCAGCAGCGACCACCACTGGGAGTTATTACCCAGA
ACGAAAGCGAGAAGTTACATCGTAAACATCGCAGGCATCACGAGGCTGGATCTGATAATGAACGTGGAGCTGAAGATGATACGCTATCAAGGGGCGGGTC
TGCTCTTCCTGCTGGAGCACTCCCCGTCTTGTTTAGTCCACGGCCTGTGAAAAAACTCTATGTCCCAACGCCATCGATTACACCCAAGTATTTCCGGTGG
AAGCCGCAGTCGATGACGCCAATGAAGTCTCCATCTACTTTCCAGCAGGGTAAACCGTTGACGCCTCATGCGATAGTACCGTCTCCAAGTGCACAGCGAC
GACAAACCTATTGGAAAGTTGCTACGGACACAAGGACGGATGGACTACCTGACATCAACGCAACGCTCAATCCAGCAACAGAAAATGAGGCGGAAGTGGC
TCCGTGGGAAGAATACACGTCCGTTGTTGAGGTTCAAGCTATACCAGAGAGTAGTCACTACCTTTTCGATGGCCCGGTGACGCCACGACCAGGATTGACA
ACGCCAGCAACGTCCACTACCCAATCAACATCCACTCAGTCAATGCCATCAACTCCAAGGCAAGATAATTCTCGCCTGAGTACTCCCATTCGTCCACTGA
GCGAAAATCCTTCAAACAATAAAGCAGTTAACGTTCCAACCACTATATCTGTCCGGTTGCAGACACCTACAAACTTGCTAGTCTCTGGAGCTAGTATCGG
AGTGACTGAGCCTCATCCACCACATCCAGAACCTGTTCCAGGGACACCAATCCGACTTCAGCCGTTGCCGCCTGTAGGAGAGACAAGTGAGGCCGAACAC
GAACGCTCAAAGTTGCGATCAACTGTCTCCCAAGTTCGTACCCCTGAAGAAGTGGAGACTATCGAGGTTGAGCCAGAACCTGTTAAACCGGAGCCAATGG
ATGATACTCTCGCGACTCCAATTGTGATTCGTAACGCCGGTGACAAACAATCAGAAGTATTTACGCAACATGTGCTCCGTGGCGTTATTCTTCGCAAGTT
TCTAAACATCAGTACCATTACCAGGAAGCTTCGCGAGACGGAACAACATGTTCGTGTGACGGCATTAAATCCCTCCGGTAGTGGGAAGACTCCGACGATA
ACATCGACTGCAGCTACACCTGGACTGAAACATCGACAATCTTCGCTGGAACGCGTCAGTGATAATGCGCCCGACGAGACTGGGGGTCCAAGTCCAATTC
TCCATAGGCTTGCATCCGTGGATAAGGCAATTAGCCAAACCGCTCATCGCATGGGGTTAATGTCAAGCGCAAGTATATCACCACTAACCGGACAGAATCT
GGCGAAGGGGACATCGCTGCGGACAATAGGAGAAGGCAAGCTACTCACTCAACCGGCTCAACTTTCTCCAACAAGGGACAAACTGAAGCGCCTACAGTCG
AATTTAGCAGACGTGAGTGAAGACGAAACAATTGCCATCCCGGTACGAGCGAAGCTTGACCCTACGTCAGCACATATTCTACGTATCTGTCGTCATGTGA
TAGCCAAGAGAGCCATGAAGTCCTTCTTGCGTCAAGAAATGTCGGTGATCACTCAGACTGAAGTGGCTTTACGTGATGACGCAGCCTTGCAACGTCGCCC
CAACTCATGCATGAGTAGCAGAAACGGATCAAACTCGAGATCTACAATTGACAATCGAACTCCGATCAAAGCTATGGATTCCGACCTCGTGGAGAGTTTG
GCAGCTTACTTGAAAGAAGGAGATCAACATATGACAGTAGACGAGCTGTTCCTAAAAGCCTTGCTGTCAGAAGCGGAGAAGGATTGGAAGCGTGCCATTC
TATTGGCTTCTGCTTGTGTGGTTATTGATCGAGAGTTCATCTTAGCAACATTGCTACGAGCTCGTTGCTGTCGTCGACTGGGACTGTGGACTCAAGCCAT
CAAGGATCTAACTCACGCGTTGCAATTACGTCCAGAAGATCAGCGTCTTTTTCTACTGCGAGCGTGTCTGCACAGCAAAATGGGGGAAGCGGAGAACGCT
CTGGCCGATGTGAACCGCGCACTAGTGCTGCATCCGCAATACACTGAAGCTTTGTTACTGCGTGCTGAGATCTTCCATCGAAGTCGTGCCGTCGGCGCAG
CGTTGCAAGACTTGACGTCTGTTCTAGTGCTAGACCGGAGTTGTTGGAGGGCGTACTATGACCGAGCGACCTTGCGTTTACGCGCCATTGAAGGTGACGA
ACAAAGTC