Description :
From Genome Similarity Track
Location :
scaffold_73:6686- 7689
Transcript NameFunction/comments
Pl_110429hypothetical protein PHYSODRAFT_313849

Sequence
1003 bases(100 bases per row)
GCATGCTCGATACCTCTACGGCATTAACTAAGGGCCATGACCTGTCTTCTGTTGGTCTAATGGAAACCGATCAAGGCGCCAAATGGATCACCACCTCCGG
TAACACAACGACCATCGAATCCATCCTCGGAGCTGGAGGAATGGATACTGTTCGCCTTCGGTAAGTTCCTAAAACATTCTAGGTAAACACATTTTGCTCA
CTCCTGTTGGTGACTTTGAACAGCATCTGGACGGCTGGTGATTACGACTTAGACTACACATTGGCTCTGGCTCAACGATTCTCCAAGGCAGGCTACAAGA
TCTACCTGGACATGCACTTCTCGGATACCTGGGCAGATCCAACTGCCCAAGCAATTCCATCATCTTGGGATGACTCGTCGGTCACTGCTTTGGCTGCTGA
CCTCCAAGCATATGTGACGTCAACGCTCAAGTCGTTCACTGACGGTGGCGTCGACCTTGAAATTCTGTCGCTGGGCAATGAAATCACCAATGGATTCCTA
TTTCCTATGGGTAAAATCGACAACAATGACTTCAGTGGTTTTGCGACCCTGTGGAAGGCTGCCCGGCAAGGAGTGACCGACGCTGTCTCGGCTGGTACAA
CACAACCGAAAGTGATGATCCACCTGGACAATGGCTGGAAGTCTGAGACCGTATCGTGGTTCTTCAAGAGTCTCTTTGCCGAAGGCACTGTGACTGCGGA
CGATGTGGACGTGTTTGGTTTTTCGTTCTACCCGTACTACAACACGGAGGCCACGATCGATGCCCTCACGTCTTCTCTTACTCAACTGGCAAACACTTAC
AGCAAACCGATCTACATCGCAGAGACTGATTGGCCTACGGAGTGCACAAAGGTTACCCTGAGTGCAGACTACCCGGTGAGCGCTGAGGGACAAACGGAGT
GGGTGGCTGCCATCATCGAGGTACTGAATGGCCTACCGGACAACTTGGGTGCAGGAGTTTTCTACTGGGAACCTGCATATTTGACTGTAGCGGGTCTTGG
TAG