Description :
From Genome Similarity Track
Location :
Scaffold_6:66848- 71664
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_6-fgenesh-gene-0.10Cathepsin, cysteine protease family C01A
Pytap_DAOMBR444maker-pag1_scaffold_6-fgenesh-gene-0.232OG-Fe(II) oxygenase superfamily protein
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.46Cyclin-H
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.65GJ14326

Sequence
4816 bases(100 bases per row)
TCTGCCGGAAGACATGCGGTTCGACGCTATTCATGTGGGAGTGGCTGTCGAGACAAAGGTCGAGGCTGAAAAGTATCTCGAGTTTCTGAAACCAGGAGGT
GGCTTACTGATCCCGCTAGGCCGAGGTCATGAAGAGCAGAAGCTTGTGAAGGTATGAACAATCCTAGTCCGTGATAGTGAGATGGTAGGAGGAGCTCATG
GTTTGCTGAATAGATGACGAAGGGTGCAGACGGCGAGGTTACCAAGGTTGACGTGATGAGTGTTTTGTGCCAGCCGATTCTGGATGAGGTGCCTGTTGAG
CAAGTCAAGGAGACACGAAGCGAGAAAGCTGCGCGTCTGGAGAAGGAGCTCAAAAACTGGCGTGAAACGTTCGAGGTGCAGCATGGACGCCGACCAACAC
GTGATGATATGATGAGTGACTCGCAGGCTAAGCAGTTGTTTCTCGATTTTGCTGCTCTAAGAAAGTAAATGAGAGATCCTTTAGGCATGGCCAAGAGCTG
CCTTGGCGGCGGCCAAGTGCTCTTCACCCTGCTTGATCTCGTTTTCGATGTGATGACGCTGGGTGGTTCGTGCGTATTTCGCAGGGTTTTCAGCGGATAC
AAACTGGGGAAGCGGCTCGACAACAGTGTCGCCATCAACGCCATTGAAGCGCACGATCGACTGACGCTTCTTCTCGGTGTTCACAACGCGATGCTGCGAG
CCATCATGATTGAGATATAGATCCACCGTAGATTCATGTGAAGGGACTCACCTCGGTGGCGACAAGTACACCGTTCGTCCAGCGTTCCAGAATGTCGCCc
ACCATGATGAAAaGGCGATCGTTTGAGACCGGCGCTTCGACCCATTCTCCACTGCGGTTGAGCAGATGCAGGCCTTCACTGTTCTGATGGATGATAGTGA
AGCACTCGAAGTCCGTGTGAGATGCGATCCCAACAGTCGAGTTTTTCACAGGAGCGTCAGTCTGCGGGTACGTGAGCAGGCGCATGAAAGCTTCGGCGCG
CTCGCTCACGTGTTGCTATGCAGTCACGGTGAGCGTTAATCAATGGACGAAATGATGATGTTCCAAACGTACCAGGAAGGTCTCCGATGGGAgTTCGAGC
ATCTCAGCGAAGCTACGGAAGAGCATCCGTGACACCTTGGTAGTCTGGTTGTACAGACCATAGACGTCGTCTTGGAAACCAGGGATCTCAGCGGGCCAGA
CATTCGGGCCAAGGCTGGAGCCTGGCTCTACATACGCGTCCGACAGCTCTCGCGCAAGATCAAATCCCTCTAGGTGCGAGATCACACCGGGTTGATACTG
TTTATCGAAGGCACTTGTTGGAGCCAGCATAACTAAAACCGTTGAGCTAGATATCACGTACCGATGGCTCCTCGAACATGGGCGTCCAGCCACGTGCGTT
AGGCGATTTCTTCACGTGATACTGAAGCTTGACGTCAGTCGGGAGAGCGAGGAATTCGTCCGAGCGCTTATACGCGCGCGCAATCAGCTCATCTGGAAGC
ACGTCCTTTGTCGGAATGGTGAAGAACCCTGTCTCGAGGCATGCGCGCTTCATGTCAGCCAGGATCTGCTGCTTGAGCGCGGGCGAGAcGCCCTGCTCAT
GAAGCAGTGGCGCGACGTTCACAAGAGGCACGGCGTCCTTCTCGACTTTGGCGGCCCTCATGACGGCATAGCGGCGCGTTAGGCGCACGCATTGGGCACG
GCGGAGCGTGGTGGAGAGCATCGTGGAGGCAGGgAGGGGAGGCGAAGCGATGGCGAGTGACGCAcGCTTGAGGTTCCGCTGATGGGATGATCACTTGGAG
GTGAAAAGGTACGCAGCGTAATGAGTCCAGAGGCAGAATGATGGTCGGCTGATGCACTAAGTTCGCGTTTGAGCAAGTGCAGTAAATTACGCTTTGTATC
TTGGTTCCTATTTTACGCGAGTCAGAAGTTGTTTtAGGGAAACGTTGGTGATTGTCCCGTATTGGATCAGGTGGTTGTTCGGGACACCGTTGCACTGCAG
TGTGCTCATGGGCATGGCGGAGAGCCGAGGAAGATGTCGTATCTGACcAACTCGACGCACTACAATAACTGGATCTTCGCGCCCGATGAGCTCGCGCGCA
TCGAGAGATTGCGCCATGTCAAGGTGAAGAACGCGCTGCGGCAGGAGCAGGAGCAGATCGCGAGCGCGGCTGCTAGTGGCAACACCGGGCTAAAGCCGAC
GCGGAAACCGCGGTCGTTTGCCGCGCTGTTGCCAGCGTCAACCACCGCAACGCGCGATATCTACGACTGGAACGATGAGATTGACCTTGACTTAGACAaG
GAAGACGAACGGGAAGAGAAAGAAGGGCTCAAGATCACACCGCTGATCGAGTACTTGTCGCTGGACCAGGAGAAACTCGTGCGTGAATTCTACGAGGCCA
AAGTGCAGGAGAGCTGTAGTCAGCTCTTCCGCACGTCCGACAAAGTCAAGTGTTGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGGGCTTTGTTGATGACTTCCGCGGCTTCAGCAAAGCCCAGGGGCGTGATCTCCCACTGGACACGCTT
CAAAAGCTGCACGCTAACTCGTGTGTTGTTGTGAACGACTTGCTTCTCACTGAACTACCACTGTGCACGTTTCCAGCGTTCTTGTCTCTCGCTGCATTGT
GCCAAGTGGCACAGGAAATGGAGAGCGACCCTCAAAGCGGGGTGACCAAAAGTGCTGTGCTTGAGTACATCAAACGAAGCAAGTTCGCCCAGGGCCAAGA
TCTAAATGCGGTACACGAGAAGCTGGACGTAGTACTGAAACGCTACATGGAATTCAAAGACACGCAGAAGTCACGTGAGCAGGATCCGGTTGTATCGGAG
AAGCACGCCAAGCAGATCAAAAAGATCTACAAGAAACTGAAGGCGCTCCACGTCGAGGAGGATGGAAAGAAAGACAAAGACGGCAAGAAGAGGAAATCCG
ACGGAGACAAGGATGGAGACAAGAAAGAGAAGAAGAAGAGCAAGAAAGAGAAGAAAGACAAGAAGTAGTACACAGACAACCGGATTTAAATaCATCACGC
CTTCAAGTCTCTATTACTCCTCGTTTCGCTCTTCTTCTTCTTCCTCCTCCTCCTCTTCCTCCTCTTCGTCCTCGTCATCCTCTTCCTGCTGCTCTGCTGC
CATTTTTTCTCCTGAGAAGGAACACATTATGCTGTCATCGAACAAGCCATTGTCATCAACGTCAATCATCACGTACTCAAGACCTCAACAATCGCGTGTT
GTGTGCGGCGTTCCAACTTCTTGAGCATCGGCGCGATGTCGCGTTCAATGTCCCAATTGGCACGCTTCGGGGCCAGATTCAACACGTCTTCTTCGTCATC
TTCTGCCTCGCCTTCCATGGCGGCATCCGTCTCTGGTTGCTGATGCTCGGCGTCAGCATCTGTGCTCTCGTCGTCCTCTGTTGCCGCCTCTTGAGTCTTT
CCGGTATCTTCCTCAGCCACACTCACGGCCACAGGCGCGTCTACGACTTCTCCGCGCTCCATTTTTTCCTTGCGCTCCTTCGCCTCGCGCAGCATCTTGA
GCCGCTTAGCGCGCGGCATCTCTTCCTCGTGCTCCGCCATGATGCTTTGGCTCTTGGTCTGTTGGCTGTGTTGGTTCGCTCTGCAGACCTAATCTAGTGG
ATCGTCCTAATAGTCCTACTACTGTAGTACAGTATTACAGTATATGATGTGTACCACACCAAAATTTCCTTGGCCGCATCCGCGGTTAAATGGGACGGAT
GGAGAAGTTCCATGCTGCGCGACTACTGTAGTGCTAACAGGCGGTACCAGGTAGATGATGCACAGGGCGAAACGGGGAGGCATGGCACGCGTGTCACGCA
AAACGAGTTGGAGATTTTGGAAACATGATGGACAGACAGAAGACCCAGAAACGACACACACACCACAGGCGTCTCGCAAGCAAAACTCAGCTCCTCCTGC
TTCTCCCGATCGACATCTCGACTTCTACACCGTCCGCTGCTTCCGGCCCAATGGCCGCCACTACAGTACGACCTCTTCGTCCTTCCGCCTCTTACCGTGC
GTCATGTCGTCGATCTTCCCCATCGGGAgAAGCCAGAGGGGgCgTCTTCTCTCTCTCTTCTTCCTGACCACAAAGaCAAGCGGCCCATGCCGCCTTCTCG
TCGACCAGTGGTCGCGGAACGGATAGAAGGTCCGTTGCGACGTGGTCGTGGGACTTGCCCATTGACCTGACTGGCGGCGACGACGAGAACTGGCCAGAGA
GGGaGAGGTAGATGTGTGGTCGCCATCCCCAAcATTGTGATAGTCGAGGCCCGCTGGAGACCACTGGAATCGCCGAGATCGCCTTGTTCCCTGGCTACGG
CTTCTCTTCTCGCGCGATCGTGTGTGCATGCGTGCTTCtCTTCAGCTGTCGGTATGTTGCAGCCCATCGATTCTGCCTCCGCTCTTCTCCTTCTCGTTCT
CGTTCTTCCATGCAGATACCCACGGGGGTgCACCATGACCGAACACGTGTCCATCTCGACGGGTACCGAGCGAAaGCTCCGAGAAACCAAACACACCGCA
ACCAACGAGACAGCTC