Description :
From Genome Similarity Track
Location :
Scaffold_173:66840- 81329
Transcript NameFunction/comments
Hyaar_Emoy2811864ATP-dependent RNA helicase dbp4, putative
Hyaar_Emoy28118652-haloalkanoic acid dehalogenase-like hydrolase
Hyaar_Emoy2811866hypothetical protein
Hyaar_Emoy2811867PREDICTED: DENN domain-containing protein 5A
Hyaar_Emoy2811868hypothetical protein
Hyaar_Emoy2811869ubiquitin conjugating enzyme E2

Sequence
14489 bases(100 bases per row)
TTGAAGTTGTCGCCTCGTCACATTTTTCCACCAGCTGGATTTCTATATCTCTTCGAGGCACAAATCGTTGCCACTTGCCGTTAGAAACGTAATAGAAACG
CCAGTCCTTCCAGACCAGCCATTCCCAAGAGCTCCATGGCGTCGCGTGCGTTCCGTCAAGCGCACAGCCGCGCAAAGCCCATCGACCGACACGACACCGA
CAAGAGCAACAGACACAGCAACAACGGTCCTGCTATATCCGTCGCTGATGCCGCCGTCAAGCAGAACGAGCGCGAGCGGCTGGAGATTGAGCGCCTCGAA
GCTCGCATCACTGAACAGACTCCAGCTCGTGGGTCGCAGCTCGGTGACGCCACGAGTTTTGACTTGTTTCCACTATCGGAGAATTCTCGACGGGGTTTGA
GGCTCTGCGGCTTTGTGACGCCCACCAAGATCCAAGTGGGTGCGCTGCCGCATGCGCTCGCAGGACGTGACGTGCTTGCCGCAGCCAAGACGGGCTCAGG
CAAGACGCTGGCGTTCCTGTTGCCTGTGCTGGAGAAGCTGTTCCGCCTTCGCTGGAGTGTAGAAGATGGACTTGGTGCACTCGTGATCTCACCTACGAGA
GAACTGGCACTGCAGATCTTTGAAGTTTTACGTAACGTTGGCAAGGCCCACACGTTCTCGGCTGGTCTTGTGATTGGTGGCAAGAACTTTCGGGAGGAAC
AGCTTCGTCTTGTGCGGATGAACCTGCTCGTGTGTACACCTGGTAGACTGCTGCAGCACATGGAACAGACACCGGCGTTTGATGCAAGCAACTTGCAAGT
GCTGGTACTGGACGAAGCGGACAGGATTCTGGATCTCGGTTTTCAGAAACAGTTGACTGCAATCTTGGAGCACTTGCCACCTGCTGGAGCGCGACAGACC
ATGCTCTTTTCGGCCACACAGACCAAGTCGGTGAAGGATCTGGCAGCGCTGAGTCTGCGTGAACCCGAGTACGTGGCCGTGCACGAACACTCGACGAATG
CGACACCTAAAGGTCTCACCCAGAGCTACGTGGTGACGCCACTGGAACGCAAATTGGATGTGTTATTGTCGTTCATCAAGTCGCACTTGAAGCAGAAAAC
GATTGTTTTCTTGTCCACGTGCCGTCAAGTGCGCTATGTGCATAGCGTCTTTTGTAAGCTACAGCCTGGTATTCCACTTTGTGCGCTGCACGGGAAGTAC
AAGCAGGGCAAGCGTGTAGAAGTGTACTATGAGTTTTTGAACAAGCCGGCTGCTGTGTTGTTTGCGACGGATATTGCGGCGCGAGGGCTGGATTTCCCGC
AGGTTGACTGGGTGCTGCAGCTCGACTGCCCTGAAGACACGGCTAACTACATTCACCGAGTCGGTCGTACAGCACGTTACAATAAGCAAGGAAAAGCGCT
CATGTGTCTTGTGCCGTCCGAGGTGGACGGCATGTTGAAGCGTCTCGAGGCTGCCAAGGTGCCCATCAGTGAGACGAAGCTTAATCCAGCCAAGACCACA
AGCTGTCGGCAAAAGGTGGCGTCGGTCGTAGCCGGTGACAAGGATATCAAAGCGCTGGCACAGAAAGCTTTCATGTCGTACGTGCGCTCGGTGTACTTGC
AGCCGGATCGCGAGGTGTTTGACGCTACTGCTCTACCGCTGGACGCGTTTGCCGAGTCGCTAGGACTTCCTGGTGCACCACGGATGCCCTTCTTGTCCAA
AATGAAGGCGGAGCATGAAAAGGGTGGGAACGAGGCGCTGCGGGATGAGCTGCGTGGGAAGAAGAATGTCAATCGTAAGCTCCAGCAGCTCAAGGAGAAG
ATAAAGGCGGAAAAAGCACGCAAGCGTTTAGCACGGCAGCTTGCAACAATGGACCCGAAGGAACAGGAAGAGGCGATCAACAAGGTGGAGATGAACCAGG
AAGACAATGAGCTGGATGAAGTCGAGGCGGAGGAAGACTCGCTCATGGTTGTCAAGCGCGTGCACAACTGGGCAGACGATGACGAGCCACTGGACCTTGA
AGCACTTGATCGTCGCAAGCAGAAGAAGCAAAAGAGGCTGCGCGTTGACTCTGAGGTCATTAACACGTCCAAGATTGTGTTTGATGAAGACGGTAACAGC
GGCACGATCGCCGACGGTCTCGCCGCTCGTAACAGCACCAGCAGTGACTTCACTAACGTCGAGCAACATGCCAAGGAGTACACGGAGCAAGTCGCTGCTC
GTCTAGCCGCCAAAGACGCGAAGGATCGACGTCTCGAGAAGGAACGCGTGCGTGCCAAGCACCACAAGAAGCGCATGCAAGTCAAGGGCGAGCGAGACGA
GGATAGCGACGACAATGGCCCACGTCTTGCAGTGGACTCGGACGATGATGACGATGACAAGGACGACGACATGAGTGGCAATCGTAGCGAGAGCGACCAC
AACGGCGAGACCAGCAGCGACGACGACGACGCCAATGACGATAACAACAAGAAGCAGACGATCGATCGTCAAGCCGTCGCCAGCCAGGAAGCGATGGCAC
TCCAAATGCTGCAGCATCGATAGACAGACCGATAGACCGAAGAAACACACCTCCTGATGAACCTGGACGCAGCTTGATCATAGCCGTCACCTCATTCCTT
CCTGCTTCAACATCATACTTTAAAAGAAAGGGTCAGTCCAACCTTCCCCACCAACACACTCACCTCTACCTACCGATCCGTCCTTCCGTCCATCAATCAC
CATCTCCCTCCTCCTCCATCCAATGTCCTCGTCCACTTGTCGCCGCGTCCGTGCCGTGGCCATGATCCTGGACGACGTGCTGTACGACCACTCGACGCTC
TTGTCCCACTTGGCAGTCGACCGTGGCCTCGCCCAATTGCAAAGCGAAAGCGCGTTTCCAACCACCACAGCTGCAGTCCAAGCGCTCGAGACGTTCCGCA
AGACGTTCGGCCTCCGCGAACGCTTTCCCCGTTTCGTCGATAGTCTCGTCCATGGCTTCCAAGCGAAACTCTCGACAACGCAAGCGCAACGAGTCATTGC
GGCTTACTATGAGAGCAACGTCTTGGACGCCCGTCAGATCCAGCCGTTCCCAGGCGTCCGGGAGACGCTCGTAAAACTGCAGGATGGAGGTGCTTGTTCC
TTGGCGCTGCTGCTCATTGGCAAGCCAGAGGTGCAGCAGGAACGTCTTCGGGCGTTGCAAGTTGAAGACCTTTTTCAAGAAATCGTGTATGTGGAATCGA
ACCCGAGCTTGGCTCAAGTCACGAGTGGCATGAAGCAGCTGGTTCGTCAACTGGACATACCGTCATCGGCTGTTCTGTTTGTAGGACGCAAAGTGTTCTA
CGAGATCAAGGCTGCAAAGGCTATTGGAATGCTCACGGTGCGAATGGTACGTGCTGCACTGTTGATATTAGATGGAAACCAATGCGTTGGGGGATAGAGC
TAACGTGCTGGGGGTATGGGGTGGATCCTCTTTGCTGCTGTTGTGGTGGTGGTTCTAGTTGTTTGGCAAGTACATGAGCGTCATGCCGACGGACGAGATG
GAGCAACCAGACTTTCAAGTGGGGAACAGATATATCCCAGTGTCGTGCGATATCGGCACTTGCGTGGAGACTGATGGCTTCAGTGCTGTGCTTGTGTGTG
ATGTTTCTGCTACGGGGATCTACGGATAGATTGAGTCGATTGCGCAGCTGATAGCCGTCGTCAAGCTGGCAGACCAGCAGATGCTGCAGCCCAAGATCGT
GGCTATTGGAGGTGGTACGGGACTCGCAGTGCTGCTCAAGGAGCTGCGTCACTATCCAGCTGACCTCACAGCCGTCGTCACAGGTTGGTACAGTATTTCC
ATAGCGTGAACGAAAGCGGGGTTGGTTGCTGCAAAATTGCGGTGGATCTCGTGACTGAAACGGATGCTGTCATGCATTGTGCTCTAGTGTTTGACTCGGG
TCGCCATTCTGGTGCCCTTCGCAAGAATTTGGGCATTTTGCCACCTGGAGACATTCGCAACTGTCTAGTGGCGTTGTCCGACTCTGGTTCGTACTCCTTG
TTGCATTTCTGCCATCTTGTGAACGGGTCCTCAACTCCTGATTTCTTCGCTGTGCGCACGATTAGATGAGCTCTTGAGCAAACTGATGAACTACCGTTTT
CGTGAAAACTTTATGGACGGTTGTAGCTTGGGTAACCTGCTACTGGCAGCGTTGACCGACCTGCAAGGTGGGTTCGACTGTGCCATCTCGTCAATCGCTG
ATATCCTCAACATCCATGGCACCGTGCTACCGGCCACACTCGAAAGCACGGAGCTGTGTGCCGACCTCATGGACGGATCCACGGTCGTTTCAGAAGTCAA
TGTGCGCAGCCCGTTCATGCCTCATGCGGAGGTCGAGTCTCAACCAGATTCCAATTCTTCATTTAGTAGTGCAACTGGAGATTCGCCATCGACGTCTTCA
GAGCCTCGATACTCAAAGGTGAAGAAGATCAAGAAAGCGCCGATCAAACGTGTGTATCTGGAGAATCCGAGCGTGCAAGCTTTTCAGCCTGCGGTGCGTG
CCATACAGGAGGCCGACATCATCATCTTGAGTCCTGGAGGTTTCTACACATCGATCATTGCCACGCTTTTGGTGCCAGGAATTCGTGATTCCATCGCACG
CAGCTCGGGTGCAGTTGTCTACGTGAGTAATATAACTACGCAGAATGGTCAGACTGACGGCTACACGCTAGAAAAAACACTGGAGGTGCTTTCGACTTAC
CTAGGAGCGAACGTTGTCGACTACGTGATTGCAAACAACGCTTTTCCACCCGAAGATGTTCTTGTGCCGTACCTTGAGCGTGGAGAGGAATTGTTGCTGC
CAACACCCGAAATAGCGGCTCGCGAGCATCCTGTTTTGCTTCAAGGCCAAACGTTTCAAGAAGATCTTGTTGCGGGGCAAGTGCCTCGCGAATGGAAAAA
GGCACCTATGCTGAAGCACAGCGGTCGTCGCGTAGCTGCCATTCTTTATACCATCATCGACAAGGAAATGGCACGCCACCATCAATGTCAGCAACTGCCA
CCTGTTGTTCCCAGTGCAGCTCCAGCGAATGTGCCACATCAGATGTGCTCATGGATGCCACCTTTCACAGCTTCTGCAACAATCTTTGGAATTCTAGGAG
CCACCACGTTCTTAGCATCCGTGCTTGGTCGTAGGTAAGTAAATCCAAGCGCTACACACAAAGCTGAGCAGACAAGAGTCACAACAACAGAGAAGATGAG
GAGCGCAAACGTCACGTACATACAAGTTCTACCATCCGGGCTACTCAGCACTCACGCATAACCATCGAAATCTACCTGGCTTATTACTGTGGCAGGGATG
ACACCGAGGAAGAAGACGTCGTAGACGATGTCGAAGAAGACGATCCCAACAGCCCCGGTGTGATTTTAGACTGGCCTGGTTGTTCCTCGAAGCCGTGATG
TGTGACCATGAATTCGGAAAAGGCCTGCGTAGCAATAAACAGTATTCGGAAGTCGCGCATCTCAGGTGTGGAAGCTGCGAGGTAGCTGGCCTCGTCAAAA
AAGACAGTCCGCTTACGCGCGAACTCGTCTGTCCAAACGTATCGATGGTAGCCAAAGTCGCCGATCAGCTTATTGATAGTCCGTAAGAACAGCCCTCGGA
CGGCGATCTCCGGAAATACCAGAGGCTTACTCGGGAAGTGATGTGCAAACACATGGTCACTGCGACTCACGTTTGGTTTCAGACACTCATAAAGTGCATC
GCGCAGACCAAAGCGTACACTATCGGGAAGGGCACAGGGTACTTCTCCACGTAAAACAGCCCCCTTGTCCAAGTCCACAACCAACAACTCCTCACCGGCT
CCGGCGAAAAGATCATCACCACCCTCCTCAATAACTTGGCGCTGCGCGTCGTCCAGCGCTTGCTTTTCAGCACCGAAGATGAAAGGCGTCGGACACTCCA
GATACTGTAGCATTCGACGTGGAAGAACAGGAAGGTACACATGAGGCCAGGACAGGGGGTGCATGAGTGCTCGCAGAGATTCCGCCACCTTCATGAGCAC
TGATAAATACGAGGACACCAGCAAAATCCGATTCTCCAATAAGGCCGCCGTGAAGACAAGGAGAACGGTGGACACATCCAACGTGTCGAACAGTAGACGG
ACAGAGTGGTCTAAACGTGGAAGAGATGCAAGTAGTGATGCAGCTGTGGCTTTCGGAACCAAGCCGGAGGATTCGAGTAGCGGGGACTCCGGCAATGGTG
ATGGTTTGTGGTATTGTGAAATGTGTTCCTTTGAGACCGCTCGGGTTAACTTGGCAAGCACCCTCTTGTCCAGCTGAAAACCTTGTCCACCATTTCGGAT
TGTCATTGAGATGTCGGCGTCGGTGTTTGGAGTAGTAGCAGCAGCAATAGTCTCCAGCTCAAGAATGTACTCGTACGCTTCTGCAAGACGCTCTCGTAGG
AGATCCACCATTGGAAACTTTGACAGCACACATACTCCGTAAGGCACCCATCGGCAACTACTTGAAAAAGCCACTCGGGATGTCTCCAGTACCCGCCGCG
ATAATGGTGGTGCTGGTTTGTACAAAACAATGCAAGCCGCAAAGAACTCAGCAGCCGAGGCGCCAGCGCTGCTGTCGCCCATGCGAAAGTTGAACGCAAG
AGGTGCTGGACAAGACGAAGCTGTAACAACCACATGCCTAGGGTCTGCACACCAAGGAACGAGAAAATTCTCGATCGATTTGTCCACAACGTGTATTGCT
GGGTCATGCGGCAGCTGATGCTGTACAATGTGCAGTTCAATCGGGTCTTCAAATGCACCGCTGTTGTCAGCGCCATATTCTGCTTCTTCATCCATCAGCG
GCACAGATACAGCTTCGAAAGTGAGCACGCCCGAGACAGCGTCAAAGCTTTGCGCTGTACGCAGTGAGTCAAGAGTTTTCTTCTTCGGTGTTGTCGCATC
AGCTTCGCGCGTACTGGACGGCGACGACGAAGTGCTCGAGCTGCCACCAGCCCAATGATGTGCACGCAAACCATAACTCAACAGCAGGGCCGAGAGTCGC
ATGAAATCATCGATAGAGTCTTTCTCGTCTTCAGACGATAGTTTTGGATACAGTGAGAATTCAGCGTAAGCACGGCTTGTCAGAAAGCGATGATACAACT
CCAGGTGAATGAGACTAAATCTCGTCAAAATCGCGTCTTGCTCCGCCTGAAGCCGAGCACAGGATGTCACCAGTGTGCGCGACAAAGTCTGCATTTCAGC
GTCTCCAGCATAGTATTTTTGGGAAATGTACTTGAGCAACCTCCTGCAGCGGTACGCGGACTGCTCAATGCGCTCGCGGCGCTGGTTGCTACTAGATGAT
GCAGCACTTCGAGAACTGCCGCTAGCCTTGAGCATCGACATATATATGCGAAACGCCGGTTTAAACTCGTATTCGACATCCAACCACAACGCAATCTCGC
GGTGGTAGTTGTGCGGGAACAAAAAAATCCAGAAAAAGTTACCAAACCGGTGGTTCATCAGTATGTCCTCAAGGCAAATGACTTCACGCTCCACTGTCTT
CTGCATCTCAGCATAAAGCTCCGTTTTACGGAACTCAGGAAACTTAAACATTAGTAATCGTTTCACTTTCACGGCAACATCATCAAACGTGCGAAGTGCA
TCTTCACCCCCGGCCGCTAGATCGTGTTTGATGGAGCGCAACCTGTTAGGTTCCACAAGCGGTGGCTCGTCACTGCCACCCTCTACGGTGTCAGCACTAG
TAGGACCATTGATCGGAAACTGGGCATTCTTCGCCAGATACTTCATCGCGATCTTGACACCGTACGTGCGTAACATTAGCACATCGTCCTTCGCAAGAGG
CTGTCGCTGGTTGTTAGCACGCAACGTACACCAAAATTGACGATATTCCTCAAATGAACAGAGGAAAAACAACTTACTTTGATCCGCAGGATCAGAAAGC
CATGCTGCATAGTAGCGCATCATTCGTGGGTTGCTGATGACTTCCTCAATGGAAATAAGGGTAGTTGGGTCAGGAATCGGCTGGTGTGGTGGAAACGCAA
ATTGCTGTTGCTCCCGTTGCAGAACTCCGTCCTTATAGGCACGCTGCATTACTTTGCCAAAATTGTGCTGATATCGATCATGCATCCATCGGTTCCACTT
CTGAAACTTGGCGCCACCATGTGCTGCTGGTCCAAACGACGGTAGCGGGGGCAGCAAGGAGTGACGGTTTGTGGACGACGAGAGCACAGCGTATCCACTA
CCATTACTTATTTGCGCGAGTATCTGCTTCTGCTTGTTCGCCCAGATCTCTGCCGACGTCGGCGCAGTCGGTGTCATGTCACCACCACAGCTGCTGTTGC
TAACTGTTCCATTTTTGCTGCCGGCTACTGTTGCATACAGAAAACCCCGTGCCTTTAGTTTGACGTGCTGTGCCCAGCGAGACTTGGCATTTTCGAGTTT
GACACCCTCCTCTTCCTCCTTTATACTCGTAACTTCGTAAGCATTGACATCGTCATCTGACCCGCTCAGCACTTCAGAAAGCTCTCGAGCACTCAGCTCA
CGCTCCGGTTCAAACAGATCCGTCTCATACAGCATCAACTCCGATATAGTACTTCGTCGAAACGTACTACGACTCGAGAACGAGAAGGCTAAACTGTCCC
GCGATCGCTTTGACATGGCAAACGAGTCCCGATCAATGACTGTAAACGTCCCATTACCCACTGCATGCGATCGTCGTTGATGGGGCAATCGAAAATCATC
CTTGTCCACATACAACGACGAGTTCAGTGCACTCGCCAAGCTCTCTCGAATCACTTCCTCTGCCGATATCGTGCTATCTGGAGGTAACGGCGGACTTGCG
TCCAACGACGCTAGTTGTTCAAAATCAATGAAAACAGACCAACAACAGAACAATACATAACGTAAGCATCTCGACAACCTCTTCGCAACCCCCTCTTCTT
CTACTCTACAACGTACAAGCTCTTCGAAACCTTTCGGCACCACTGCTCTTTCTTCCACCGGTAGAATCTCCCAGCATATTCCGTGTAAGTCGTCCACCAT
CAGCCACGGTATCTCGATCCTCCAAACTCGTCGCTCTACCATCACCATCAGCAGCAGCAGCAAAACCGACACCACAAACACCATCTTCATCCAGCAACTC
ATTGGCAGATTTCACATCGTCCATCAAGAAGCTCGCGTGGCTCCGCAGCGATGCGGAAGAAGACGCAGGAGCGCTTGCGCCCGCATGAAACCGCGGACCT
GCGCTCTTGTGCAATTGGTGCGAAGCGCTTTCTTGACCATTGTGACCGAATGGGTAAAATCCTGAGCGACTGGGACGTCTTGAGCTGCCTACAATGGCTT
CTGCTGACGTACAGCGTCGGAGCTCTAAGACGTCGCGAGACAAGAGCGACGTATGCGGCGTTTCTTCGTAGCTTGCGCTGCGATCAATGCGTAGATTGGC
CGTAGCAGCGGTAGAAGAAGCTGCAGAAGGTAATGTGGTCAATACCGCGTTGCTACTGCGACTGCGACGGCGAGGACGCGTGCGGAGACAGACGCGCACG
ACGTCGTCGCTCATGTCGAGTGTGTGTGCGACTACAAAAGTGACGATATCGTACGTAGTCGGAGTGTACGGGTATATCCCTTGTGTGGTTGACGTAAATA
ATGTGGTCGACGTACTGGGCGTGAGTTTTGTAAGCGTGTGTGGTGCACACAACTATCTGACCTTGGTATTCTCAGACAGCTATCGAGTTGTGATCTATCT
TGTTCGATCGGGATGACTGAGCGTCGAGAGAACGCAGCGCAGGACGCGGTGATCAAGGTGTTGGTGCTAGGTGATGCAGCTACGGGGAAAACGAGTTTTA
TCAAGCGGTGCAGTTTGTTTTTCTTTTCTTGAGCTGATGAAGGGGAGACTACTGATTGACTGGTTGATGGTGAATCAGATATGTGCACGACGTTTTTACC
GAGCACCACCGCACGACGATTGGCGTCGACTTTGCTCTGAAGGCAGTGACAGTGTCTGGAACGACTGTGCGACTGCAGCTGTGGGACATTGCTGGCCAGG
AGCACTTTCGTGCGCTGAATCGCGTCTACTATAAGGACGCGCTGGGAGCGCTGCTCGTGTACGATATGTCGCGCCCAGAGACGTTTGACAGCATTCTAAA
GGTAACAAGAGGGAGGTGAAAAATGAGAAGAACAAAATGTGCTGTTGTTGATGTTTTGATGCTCATTGTTTGGTGATATATCGTGCTGGTGGAGATGTAG
TGGAAGAAAGAGATTGATTCGAAGGTGGAGTTGCCTAATGGCAAACCGCTGCCGGTTATTCTATGCGGCAACAAGGTGGGAATTTGCGAAGATTGCCTCT
TGGATCATTGCAAGCTGGTGCTGCTGCAATACGAGACACTGGTGGTCGTTATGGTAATTGTTGATGTGATGGTGATTGCGTTTTGCAGTGCGACTTAAAA
GAAGATGTGGACCGAGAATTTCTGGACGAGTTTTGTGTGACGAACAATTTTGCGGGATGGTTTGACACGTCAGCCAAGGAGAACATCCACATTGACGACG
CTGCCAAGGCGCTGGTTGTGGGCGTGTTGAAGCACCCAGACATTTTCGAGCGGAAATCGGAGGCGAAGAAGCGTCACGATACGTTCCGCCCTATGAGCAC
TGCTAATGGAGGCAACAGCGACCAAACCGGTTGGTGCTGCAGCAGCTTCTAATCTACCATTCTGTTAGCTGCAGGACCAACAATCATGCAGCAAATTCAT
TTCGTCGTCCAATGTTGCATGTCGGACGACGTTAATCTGACTTTGGTGTTGTGCAACTTGCGTATTTTATATTGTGCTCAGTGCTAATCATTTTTTCTGA
CACTACCTGTAGCTACTGGTTTCGAATCTAGTGAGTCAATCAAACGCCGCTTTTTTAAGCTGTCATCCGATGTTCTGGCGCTCCTGGTACCACCAAAGTG
TACTGGGAGATGGCGACTAGCGCTAGATAACATGCCATGACGCTCCATGCTTCTACGCGTCTTTCGAAGGTCGGCGCTCGTAGCGCGAAGGTTGTCCAGC
AACTTTTGCTTGCTGGCCTCAGCTTGGTCTAGTTCGCCTTCCAGTTGTATTGTCTCTTGCTCTCGTCGATCGGGCCGGTCGTTTGTAAACGAGGATGTGA
TATCGTCAACGATCCTCTGCACCATCGCTTCAGCCTTGGGCTGCTCCGCCTCCATGCGATTCACAGATCGGACCAGACGGCGTTCCTCTACACGTAAACA
ATATTCGCAAGACTCTGTTTCTCCACGGGCTTTGCACTGCGACAAGTGCGCGAAGTGGTGCTTCACCTTGGCACATAGCGGATGGCTGCACACCTGCAGA
TCGAAGTGGTGTTGCAGGTGCGCAAGGATCGACTTGCAGTTAAGAAGACACCGCTGTGCTTTGGACGGGACGCAAAATAAGGCGTCCACAATGGTGTAAC
CCTGTTCCATGATTTTGTCAAACTCTCGCTGTGACACTTCCCTGCCCTCTCCATCTTTGCTTTTAGCTCGAAGTAGCGCGTCAATGGAATCTGCATCGGT
GTTTACATGTCCCGCATCTTGGATCCCACCGGGTTTCTGCCCTATTCCAGTAATGCCTATAATCGCAGTCACAACCCAGTATTTTACAATTCATGCGCAC
ACCACAAACGATCATCGCAAGAGAGTGCTCAAGGCAAAGAAATACATACCTGAAACACAGTGGTTTCCGCCTTCAGCTTGAGCCAAAGACGGTAGCTCTG
TTGCTGCAGATTCACTTAAACTGTCTGCTTGCATATCAAAAGCAGGAATCTTCGCTTGGGTCTTTACTGGCATCGGTTCTCGTTTAATAAACGGGGTGTC
ATCAAAATGCCACTGGTACCTTGGAAAGTTATAAATTGGGGCGCTGCTTTCGCTAGCTAATTGATTCAGTCGGTCCGTTTCAGCCCGGAGAATCCGCTTA
CGCTCTTGCCACGCATCGATGCTTTGCAAACGAAAGCTGCGGCTTGCTTTACTGTGCACACCCTGGAGTGCACGACGTTGATCATTGATGAGATAATCAA
GTGCCGAACTGACACCCATACTTCGCCGTTGACGAATGCGAATGCAAAACGGACACACAAAACTTAAACTGTCGGTGCCTCTCATCCCACAAGCGCAACG
ATGCCGACAAACGGTTGCTATCTCGGCACACTTCGGATCGCCACAACTCACGTCAATTTTGCAATGTTCATAGTGAAGGAGCACAGAACGACACGATTTT
TCTTCGCACTTTCCAATCCGTGCGCAGATAAGCGCATCCTCAACCCGAAGGGCTTTCTCTATGTGTGTTGCCAGCATCTCCGTCAACATGCGGTCTGTTG
TGGGAAACCACCGCAGTAGTTTCTCAAGATCCACAGGCTTCAGCTGAAGGGTAGCACTCGCAGTATTTAATATTCGCTCTGAAGTTGGACTGGTAGCAGG
AGCAACAGTACGGATATGCTCTGGAGGCTTTAACATCGTTTCTGGACCATTTACTGAGGTTGCAGCCGCCAAAGCCAAAGGATCTTCATCCAAAATAGGT
CTAGCTGCTTCATCTTGTACATGCACATCATTGGTATCAACAATAAGAGCAGAAGGCGGAGCAGGAGAGAGTGCGGGGGCAACTAAAGCTGCTGAAACCA
CCGGATCGGTCTCGGCGTCGTGGTCACATGACTCCATCAATTCTTTCCGGTTCTGATCGTTGTCTTTCACTCTTTCTTTCAATTCCAAGTCAATGTTGGC
TTCTCGGACCACTTCTTCAGCAGCAACCGCCGCCTTCTCCTCAAGCTCCATCCTCTCTTTACTCGCAGCGTCGCCATCTTCTCGACTGCATTCGGCACCA
CTCATCATCTCACACTCCTTCTTTTCCTCCACACACTTATCCACGTTCGCACCCTCCGCCTGTCTGCGTACTTCATCCTGTTTCACGACGCTTTCCATTG
CAATTGTTGCATTCTCCTCAGTAACTCCTCCTCCTGCAACGGTTACTTCAACATCATCTGCGCATTCCACCGCAGCCTCCTGAGCTCGATCCCCATTCAC
AACTCTTGCATCACCTTCATCTGCTCTTGCCTCTGCCTCTACGCTGCCGTTCCGCGTGTCGACGTCATGCGGCGATGAAGTCGTCCAGGCACTAAACGAT
TGCGTTCGTCCGTCGCTGGTCGTGAGTTGATGACTACGCGCGATGCCGCGTGAGTGCCACAGAGTCGAGCAGTTGGCGCACAAGGTCTTTTCTGTCCGGG
GGTCGCACGCCCGACATCGGTAATACCAGCGCCTCGACTTGCACCAGCTACAGAACTCGTCCATGATGAAGAACGTGCGTGTGTAGTGTGGCGCACATCA
CACATCGCCCCATCGCAATAGATCAGCGACCACTATTTCCGATATGCAAAAGGGAGATATAGCTGCGAAAACCGTTGTCAAGCAGAGAGGAAGGAAGTGC
AGCGTCACGTCACGTCGACACTTAGCTCAGTACGTCGTCCGCCATCGGATAATAGCTGTCTCGCTCCTTTGTCTCCATCAAAAGAAAAGAAGGGAAAATG
AAGACCGCTCGTTCGGTCCCGACCGCACCCACCACACCACCTGACTCGAATATACGCGAATAGACAACAACCCAGACTGAATGTTCGCGTGCTTGCATAT
TTTTCTTCCTGCACCTTACCGATACTGTCCACGTCCCCTTCCTTGCCTCTGCCCTACGACAGCAGCTTCTGTTGCTACACCAGCTACCACTACATAACTG
TGTGCGGCGCAGCTAGCTAACTCGCTAGCGGTCGATCAATCCAAGCATCTGGCCGACTGCCTGCCTGTCGGCAGAGACCGGACACGTGGACAGGCCGACA
ACTCTCCCTACTCTCCTAGTGTGCTCTAAGTGGCGTACTTGGCGGTCCATTCACGAGCACTGGCGTCATGACGCGCGCGGTCTGTTCTATAAATTTGCGC
GATCTCCGGCACCAGCGGGTCGTCCGGGTTGGCGTCCGTCAATAGCGAACAGATCGAGAGAAGCACCTTGGAGATGGTGAGCGCCGGGCTCCACTGGTCC
TTGAGAATGTCCAGACAAATGCCGCCGTTCGCGTTGATGTTGCAATGGTAAATGCGCGTCGTGAAGTTCACCTTGGGCGGCTTAAACGGGTAGTCCGCTG
GGAAGTATATGTTCAGAAAGTAGACTCCGCCCGAGTACGGACTGTCTTCGGGGCCCATAATCGTCGCCTGCCAGTGGAACAGGTCGTCGCCCACAGGGCC
GGCACTGCAATTCGCGGGCGGGTCGCGCCCCAAGTCCTGTAGCTCCTTGTTAATCCGTTTTGAAGCCATGGTTTACAAAACGCGCTTCCTTTCTCGGGCT
TTGACTCTGTAGCTCTGCTGCTTTCTGTTACGAAAGGGAAATGAGGGCAATGTGGAAGAAAGCTCGCACGATCCCTCGCATTGGACAACTAACCAGGCGT
TTCGTATGTCGAGCAGTTGCAACATCAGGGACTTCTGGAAGTTTTCTCCCGTTTTGTACAGACACGGGTGGGTCCAAGCTATCGTACTT