Description :
From Genome Similarity Track
Location :
Scaffold_44:66816- 70765
Transcript NameFunction/comments
Physo_136210reverse transcriptase

Sequence
3949 bases(100 bases per row)
TGTCGGCCTCTCCACGCGATTGCATCACATGGAACCTCTGCCGGCTCCGTCGCTTCTGCTGGAAGTCGAACAGCAGACCACCACAGTTCAGGTGTTCTTC
CTTGACCCAATTCGTCTCTGCGTGGCCCTTCCAACGCACCAAATATTCCTTGAGCCGTCGACCGTAGCGGGTGCGTCTCTCCGTCTTGACATCCAAGATC
TCTTCAACTTCATACTCGTTGTCACCGCGAGTTTGTGCCTCCCAGCTATCCTCGGGGAGAAGTTCTTCGTCAAAGTCAAATCGTTCGCTTTCATCAACAG
TGAGATCTTCGGCGGGTCGTTCGGGGAACTGACGGACCAGCTTCAGCTTCGAGATGTGTACGATAGGGAACAGTCGGTAGGCAGTCCCGCTGATTTCCAG
CTTGGCAGTGTAGTCGCTCACCATGGTGGCGACTCTGAAAGGCCCATGCCACATGTGAGCGAGCTTCCGAGCGTATCCGACCTTGACTCGGTCGAGGTAC
AGCCACACCTGCGATCCCTCCTTAATGGGTGACTCCGGTACGTTCTCATTGTGGGCTTCCGCGCGACTCTCACGAGCTTCGGCGAGGAGACGACGAGTCT
CTGTCTGAGCACGTTGGTATTGGCGTTGGATCTTGAACCTCCATTTCTGTGGGTCGAGATCTCAGCTTCCGGTCCCTCCAACAGCCAACGATGCCTCGAT
AGTCGTTTTAGGGTCCCACCCGTGCAGCAAAAAGAATGGCGTGTCCTTGCGTACTCGGTCGTGCGATGTGTTCAACGCAAACACCAACCGCTCCGCATAT
TCATCCCAGTCCTGTTGGTTCTCGTCTTCAACGTACATCCGCAGAGATCTGGAAATAGTCTGGACCATCCGCTCCGCTGTGCCGTTTGCTTGAGGTCTAT
ACGCGAGCGTAGATCGCTGACGCTGGCCCAGCAGCGCATTATACGACCGGAAAAAGTCGGACATGAAGCTCGGTTCCTGGTCGTGCCTGATTACTTCGCT
GGCTCCGTACCGCCGAAACACGCATTCCTCGTGTGCCTCAGCCACTGTTGGTGCGGTCCTGTCCGCGTTTGCCTTTGCCACAACGAAGCCGGTGAAGAGA
TCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTTCGGGAGGGTGGGGATATGATCCATAGCCACGACCTGGAACGGGTAATTAACGGCGATAT
TGCCCAGCGATCGCCCCCGCAAGGTGGGTTTTCCTTGTCCCGTCTCGCAGTCGACGCACTCCCCGACATACTTTTGCACACTTCGGAACATACCTCGCCA
GTAGAAATGCCTCCGAAGCTTTTGGAATGTTCGGCTGACTCCCTGATGACCTCCCTCCACACTTGTGTGGAAATGATGCAGGAGATCTTCGTGAAGTGTA
CCCGGCATTACCAGTTTCACCATAGATCCACGGTCCTCGACATCACCACCGCGCCCCTCGACTGGACAGTACATCAAGAGGCCATGCTCGTCGACCTCGT
AACTGTCAGCCAGTTTACTGCACGTCTTGGCTTGACGGCTCGAGATCTGAGAGAGATCACCGTGCAGGAAACACTTCAGTGACCAGATCCACACCTCCTC
GTCTTGAGCACGGCAAATACGTTCCAAGCGCAGCTGCTTGACGACGTCTTCCTGCAACACGGCTGGTGCGACAGTACGAGATCGGCTTCGCGTGACAGCG
CCTACCTTCGCATGGGCGTCACGTTCTTCGCGCGTCTTGAGGAGCTCGTCCAGCCGATTCAAGGTCTCGAGGTCCGTGTCATCGGTGTGACTCTCGACAA
CTACCCCGGCACCACGCTGCAGCGCCTGTCCCGCCAGCATATCCGCGGGTTGGTTCCAATCGCATTTTACGTGGATGAGTTCGCATAGCGGCCAAGACCG
CAAAATCACTCTGGCCTTCTCACGCAAGAGCTGGAGTCCCGATGACTTGCACTCCATCTCTCCCCGCAGTTGGCGGATGACTAAATTGGAGTCGCCACAC
ACAATGAGACGGTCGATCTGGAGATCGGCAATCAAACGAAGTCCGAGAAGGAGGCCATGGTACTCGGCCTCGTTCACAGTGAGGTCCGGTAAATAGCCAG
ATTCAGCCTTGACAACCTTCCATCCAGGAGCATCCCATACCACAGCGCTGAAAGCTCCACCAACTCGTTTCGGCTTGGCCGATCCGTCAAGCTGATGACG
CAAACGTTTTCTCCGGGCGTAAAAGTCGGCATCGGGATAGCCAATGCTCTCGTCGACTTCTCCTACGGAGAGATCTCCTCCAACGCTGCATCCATCTCTG
CGCGCGGAGTGATACTGGCGGCAACCAAACCTAGTAGCTCATCTTCGCCTTTCGTTAAACGTTCGATCTCTAGCAAATGGGGGGAGAGCAGCGCCGCCCA
CTGAGCTAGCCGTCCCTTCAAGCCTTTCGCGCGGAAGAGCCATGCGAGAGTCGTGTCTGGTGAGCACTCGGATGTGTCGACCACTCAGCATGGTGAAGCA
GCTATCGAGGATTCTTAGCAGAGCCAGTACTTCCTTCTCCACAATGTCGTACCCGATCTCGTGAGACCGCAGTATCCTACTCGTAAATTTGGCGGGTACG
TACACTCCATCACGACACTGAACGAGAGAGGCAGAGATCGCCCACTTGCTTGCGTACACAATCACAACAGGATCCAACTCTGGGGCAAAATGGTAGAGCA
TGGGTGCGTTGATCATCTTGAACTTCAGGGTATCGAAGGCTCGTAGCGCGTGGCCCCATCTCACAGTTGCCTCGTGATTTCCGCTGACGTTTGTGGCTCG
ACCCTTGATGAAATCGGAATCTCCGAACTCATACAACAATGTGGCATATACTGCGAAATCTTCGATGAAGCGATTGTAGTAGTTGAGACTGCCGAGGAAT
GACTGGAGAGCCTTAAGCGTTTTGGGAAACTTCAACGCCTCCAGACTTGCCAAATCTTTCGGCTTGGTGAACAGGCCTTCACCGGAGATCTGATGCCCCA
GATAGTCGACTTTGCTCATACCCCAACTGCTCTTCTCCGCGCTAATAGACAGATTCCAGCGGTCACAAACCTCTAGGAGCTTCTTGACCTTCTCACACAG
TTCGTCCCACGAGCTTGCTCCAACTAAGATATCGACGATGTAAGAGCGACGCCCCAGCACCGACGGCAGCGATCCATCTTCAGGAACACCTTCCTCGAAA
ATGTTGACGAGATCCGCGCGATCTTGACCCGGCGAGATCCGCAGCACGCCATATAACGCATTGTCGATCAGCCGCTGATAGATTTGGGGGGCATTCTTCA
GGCCAAACGGCATTCGCAGCCATTCGAACAGGCCGAACGGCGTAATGAACGCGGAGATCTCTCGGGCTCGATCGGTCATACTCAACACCCAGAACCCACT
CGCCATGTCGAGAGAACAGAACCACAGCAAACTGTCGCGATCTTCGAGGAGGTCGTCAATCAACGGCATGGGGCAGATCATCAGTCGTGTCAGAGCATTG
ACCAGACGGTAGTCGATACAGAGTCGGACGTCCACGCCGTTCTTCTTGACGACGATAACGATCGGAGACGCCCAAGGAGAAGTGGAGATCCGAATAATCT
TCGCCCCCAGTAGCCCCTTGACGAGTTGGAACACCTTTTCACGGAACTGAGGCGGGATCCGGCGACAACGCCGAGCCACCGGTCGTGCGCCACCAACGTC
GATGTCACAGATCGCCCCCGTCGCCGCAGGGGGTAAAGCATTCCCGTTGCCGATGAGAAGGTGACGCCGCTCCCAAATGATATCACGCAGACGATCAATC
TCCTCTGCTGTGTTCTCAGTTGGATCCCCGACCTTGAGATCTTCCCTTTTAACTTCTGCCGTCAGGGGGATCTCTGGTAACACCGCCATCTCCTTTTCGA
TGTCTTCCGCAGTGATATCGGCCCCTTCATGAACATACTTCGCTTCATC