Description :
From Genome Similarity Track
Location :
Scaffold_185:66811- 72088
Sequence
5277 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAACGAATGTGAACATGTTGGATGATGAAGCAGAAGACTTCCATTCAACGCACGAGAGCTACTCCTA
TTTGAGTCAAATCGAATGGGATGCCGTCGAACGTTTGAGTTCGACAATTGGGCAAGAAGTCGTAGGCGCAATGCTGTCCGCTTTGGGTCCAGACGGGCAA
CACGCCACCGTCGCCAAGTTCATTCAAAATGAACTTGACGCTGAACGGGGAAATGTAGCCTTGCTTCACCAACAAGGTTCTCAACAAACAGAGCTGTTGA
GAGAACAGAGTGCTCAACAGTTCGAGTTGTTGAGACAGCAGCAGGATGCTGCTACCGGGTCGACACACACGTTGACCCGAATCACTGAAGATTGACATCT
CCAAATATAAAGCAACTAAGGAGAACTCCCTGTTGAGATAGTTCAATGAATAAGATGGCGTCATAAGGGCTCGTCACATTTTCGATGAGCAAATGCAGGT
CGAATTTGCTCAATCGAACTTGGCAGGACGTGCGAAGACTAGGGACTTGGGACTCAAGATACACGACTCGTTTGTCTTTGGGTCGTTAGAAGTCTTCAAG
CCCTTCTTAGGCAACATTCGAGCCACCACGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAAAATCAAACATGGCAAACGTGATGTACACTTGTACATT
CAATAAATACGTCATCTTATAAGTTGCATCACGTCCAATCCGCCGAATGAACAAACGTTGATCACGTTGTTCGTACAGGGTCTCGCAGAAGGCCCGGTCA
GGACCAATCTCTTCCGATTGGAATTTGATACGCTAGAAGAGGCAATTTGAGTTGCGGAACAAGAAGATTTCAGCGTGAAACAAGCTCACGTGAGTTCGAG
TTCCTATCGTCCTCCGAGGCGACAGGAAAGTGGAGGACCAGAACCGATGGACCTCTGTTACTCTGAGAGTGAAAGCCCTCGCTTTACCAATTGTAAGAAA
TTGCAGATATGCAATAGGTGCCAAAAGACAGAGCATTATCCATACAAATGCAGTGCTCCAAACGTTGTACCACGTACCGCAGGAAACAGTAACCGTCAAG
CGGCCAAGAAGGGTCCGAGGCGTGGGTCCGACGCTGTTACAAAAATGCAACACCGTTACGGACGACCAAAAACGGTCAGGTTCAGTAGGGTGCTCCGCCC
CTACTGATCCAGCAACGTCAGGTAAATTTGCAGGCCTCTTGACGAGAATTTACTACCAACACTCAATCATTGTGTGTTACTGCATATGGTAATGAGAATT
CCCTCATTACCTAAAAACTCGAAGGGGCAAAGGACATTTCACTACGAGACCTAGTCAATTATAGGGCGGCAAACAACTCTTTACAATGCCCATCGCTAGA
CAATAGCGATCTCAAATATATCGAGCGGGACATCCCTCCAACAAGGATGACGGTGCGTCTCGCGACGGGCGCATCCGTAACAGTGATGAAACGTGTAGTA
GTACTTTCCTATACACTGAAAGAAGTCCAATACGACGATGACTTCATCGTCTTGGACTTGGATGACAAGTTTGATGTTATCCTTGGTTTACCGTGGATCA
GAAGGTACGAGTTACAAGTCAGCTGGCACCGACGAAGTGTCGATATGCCCGCCGCTTGCTCACCAGACGCCCATCTGATGAACGTCTTGGAGCGTCCACC
ACCACGGGGATGTACTACGAGTAAGTGCGATGGCCTCGCGTGTGATTCGGTCGTTAGTACGACTGCAAAAGATCGCAATATGACTAACCATCATATTGCG
AAGCAAGTTCCCGGCGAATGCATAACAACGCAGGAAGCGCCGAAGGCCCACCACTCGAATAAGTCGAGCGGACCGGGGCATGGTTGTCTTCTTAGTGGAC
AACACCTAGATCATGACCAACCGAGAAGCTAGGGTTGAGGCAATAATTCCCCAACGAACAGTGAAAATAAGTTCTCATGAGATGACAGAGACATTGAATG
TCCTGGTTAATGACGAATTAAGCATAGGTAGCCATGCCCTTGATCTGATCGCGCCTCCGAAATTAACTTCGGAGATCACTCAGTTACCCCCGCTGAACCA
AAAGAGATTCTTGCGTGATCTGCATAGTCGCAAAGTCAAGCAGATCTGCGTACTCGTCGTGGAAGATGAGTACGTCAGTGATATCCAATCGGCAATGGTC
TTTGCCGAAGATGAACGAGTTCTCATTAGCTCATCAATGGAAAAGAGTGTCCTTGATAAGGAGACTCGAGTTGAGCGATATACATCCCAATTGTGAGAAT
CGCTCAGAACAAATCCTCTCTACGATGATTTGATGGAATTCAGGGATGTATTCCCAGAAGCAGTCCCGTGCGAGTTACCTAAGGACAAAGGTACTCGTCA
CGAAATCGACCAGAAACCGGGTTCGAAGACTTGTGTCATGAAGCAATGACCACTGCCTCGTGAACAAGTACTAGCGATCGACAAATTCTTTGCAGATCGC
TTAGCAGCCGGCCATGTTAGGGAGTTCACCTCTCCACATAGATCTCCAAACTTCTGTGTGCGAAAGGCCACAGGAGGGTGGCGTATAGTATATGCCTTCA
GCAAGTTGAATGCTGCCATTGTACCGGCTCCAACCCTAATACCAAGGAAAGATCTCAACATAAATGGTATGGCAAAGAGTACCATCTTTTTATCCATGGA
TCTAATGGATGGATTTTATCAGATCCTTATGCGCGAAAGGGACATTCCCTATACTGCAGTGAGCACTCCAAGCGGTATGCTTTGGGAGTGTTTCGTAATT
TCACGAGGGCTAAGTAATGCCCCTGTCACATTCAACATAGGTGTAACGAATCTATTAAGATCCGTAAGAGAGTTCGCGCCCAGTTCCTTCGAAGATGTGT
TCGTCCATAGCCGAGCTATGGATGGACAGATCGATGTGGAAGTGCACGACTCCATGTCCGGAAAGTTCTTACACTAATGCGCGAGCATAAGTTGTACGCC
GACCTCAAGAAGTGTATATTTGCTGCTAACCAAAGATTACTTCTTGGTTGCATCGTGGGCAAGCATGGCGTCCGGCCCGATCCAGAAAAGATCAAGGCGA
TCACCGACTGGCCGGTGCCTACCGATTTCAAGGGACTTCGAACGTTTCTTGGCCCTAGCGGCGCATTTGCACAAATATTCACGCAATTACGCCAAGATGA
CTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAGGTGAAAATGGAGTGCCGAATGCCAGCGCTCTTTCAAATGTATCAAGCAAAGCTTGATACGATC
GCCAGTTTTGGCGATTGCAGACCAAGACAGGCCATTCTACGTGGCATGTGATGCCAGCGACTTTGCAATCGGCTGTGCATTGATGCAGTACGATGCAAAC
GATGCGGCACGTGTCGTCTGTTATCAGTCGCACCAGCTGCAACCAGCTGAACGCAACTACCTCGTCCATGACAAGAAACTCCTTGCCATGAAGTACGCGT
TGGCTAAGTTCAGAGTCTAGCTGCGAGGTGATAGACCCTTCATCGTTTATACGGATCATACGTCTTTACACACGGCCGTAAACAGTCCACAACTCTTGCA
GCGGATGGCGAGGTGGCTGTCATTCTTTGCGGAGTACAACTTCTCTGTCGAGTAAAAGCCAGGACGACTGAATGTCGCTGACGCACTCTCGCGCCGGCCC
GATTTCGAACCGGCTGCTCCACCCGACACTGGTCCGACCACTGTCGCGGTACTGACTTCTAGTGTCCCGTCGTCAACCTTATTGGAAGACATTCGAAAGG
ATTATGATCCGGGAATGGTGCGATTGGTGCATCATCTCTCGCACCCATCCGGGAAGAGCCTCAAACAGTTGTCGTCAGTGTATCGATCCTCAACGGATAG
ATATACAGTTTGCAACGGCTTACTCCAATGTTCGGCTGTTGCCGGTGACACACCTCGTGTCGGCGTACCAGATCATGGTGATTTTCGATTGCGTATCATG
TACGAGTACCATGACGCACCTGTTGGTGGACATCGTGGTCGTAAGAAATCATATCTCACAGTGAGCCGCGACTTTTACTGGCCATTAGTATCAGTTCGTG
CACGAGTACGTTCGGGCCTGTTAGGTCTGTCAACGGGTGAAGCCTAGTCCTTCCGTCAAGCCCTGTTGCAGCCTCTGCCCGTCCCGGCTGAGTGCTGGGA
TCTGTCTCAGTGGACTTTGTCTTCGTATTCCCCGCAGACTCTCACAAGAATACTGGTACTCCTGTGTTCGTTGACAGGTTCAGCAAGATGGTACATCTGG
TTGCTGTACCCGAACCACTCAACGCATCGTCGTTAACACGGTCTTTCGCCTTCATGGTTTGCCTCGTGAACTCGAGTCCGAATGGGAAAGTCTGTTCACA
GCATATTTCTGGCGTTCCATGTTCAAAACACTAGGAACGCTCTTAAACATTTCCACTTCTGGCCATCCTGAAACATATGGTCAGACCAAACGCGCAAATC
GTGTCCTCGAGAAGACCCTTCGAGGATACGTCCATTCCTTTACGAGTTGGAGCAATTTCCTCCCGATGGTGGAGTTCGCCATCAACAATTCAGTCCATGC
GTTGACGACCCACACGCCGTTCTTCGTTAATGGCTTGCGCCATCCGCGTCTTCCCACCTTTGTAGAGTGTGACTATCGTTTAAGGGGGGGAATCATTCGA
GCGACCGTTGATACGGCTCTCACTCGCCACGTGCTGACAATGGGGCCACCACGTTCGATGCCGATGTCGATCACATCGACTTTGGTGAAGAAGAGGAAAG
TAAGAGCGAATATGCTCTTACTGGTCACGATACTGATCAAATCAGCATCACGTCTAGTGCGTCCAAAGACACACTCACAGAGGCGGCGAGTGATCTTGCT
ACAGTACTCTCCAAGAGCACTGTAGCTAAAGACAGCGAGTCAGCAGATCAATTCATACTGGATCGCGAAACGATTGTCCGTTTCGTACAAGATTCTACCG
CAGAGGCAGTAGATCGACAAAAACAAAACGCTGACAAGAATGGAAGGACGAATGTTGTTTATATAATAAAGGCGACTTAGTCCTACTATCTACGGTAAAC
CTACCTCGACACATAGTGACTAACGTGGGTAGCAACAAGTTACTATCCAAGTTCATCGGTCCATTTCGTGTGCTGCGTCGCCTAGGCAACGCATATACGA
TTGAAATACCACGTAAGATGCGCACGCTTCTACATCGGTTGCCTTAGGCCTTACTATCAGTACGGGGCTTCTGGTGA