Description :
From Genome Similarity Track
Location :
contig_19:668071- 670344
Transcript NameFunction/comments
g5547.t1hypothetical protein

Sequence
2273 bases(100 bases per row)
GAACTTACGCGTGCGCAGCTCCTCGAGCGCTTCGAGGGCGCCTTGGCGGAAGAACACACGCGTCTTACCGACCTGGTACTCGCTCTCCTTGCCAGGCATC
AAGTGGTTCTCGAGCAGCTCACGGACAGCAGCGGCCGTCTTCGTATCGTCCGTCGGGTTCTCGTCCGCAGTAGCGGTAAGCACAGCAAGGGCGGACGGAT
TGCCGTCCACAGTCGTAGTCGACGCCACGCCACGGAAACGCTCCAGGAACATCGTCTGCAGTACACGGTTGGGGTACGCCATGCGACTGATGCGCACAGC
CTCCACCACGCCAGCGCATTGCAGCTGCTCCGTCACGCGCAGTTTGTTGAAGATCAGTGGGCTCTTCTTGCCGTTAGGCTTGATGCAACGAATGTAGTGC
ACGTTCGTGCGACGGATATCCTCCATGAGACCGTTCAGCTGGCTCTTGAACTGCGTGCCCACCGTGTCGGCAACAATAGAGTTCTTGCGCTTAAGGGCGG
GCCGCCCACGTGAAGCATTAGATGCAGAAGCTGCACTCGTACCGGGGATACCCGTCATCGCATCACCAACGTGCTCGTCCGGGAACAGCTTCTTTAGGAA
CGGCGCCTTCGACTTCTTGATCAGCAAGATCAGGTCGTTCTGAAGCGCATCCGTGTTCTTGATCAGGAAGCCATTCGTATCGTACTGCACAGGTCCGGCG
TAGTGCTTAATAACGAATGCATCGCGGGCAAAGCGCGGGCACTCGAAGCGGTCGTTGTCGCTGTAATGAGCCTTCAGCTTGTTGGCGAAGGCGGCATCGC
TACCCTTGGGGCGCATGCACTCCTCATTCAGCAGCGACAACACACCAAAGCGCCCTTCAAGCAGCGACAGCACGTTCACATTATCCGCGAACTCGATGCG
CGTCCAGGGAATGCCCTCGTCCTCATACTCCTGCTGGATGGACTTGAAGACGTCCTGCGTAAACTTCTGCTGCAGCTTCTCGTTGGCGTAGTTGATGCAC
AGCTGCTCGAACGAGTTCTTCTCGAAGATTTCAAAGCCAAAAATATCCAGGATGCAAATCTTGTGAGCCACATCCGCGTGTGACGCGCTCGTCGACATGT
TGACTCGGTGGATCAGCCACGAGAACATGTGCGAGTACAGGGCCACGCCCAAAGCAGTTCGCGCACCTTCGGCCTGCGAGACGTTCAGAGGCACCTCGTA
CGTCTCCATGACCGCCGTCATCTCGCGCGTGCAAAGCGCCGTGTGCAGCTGGTTGTCATCAAACTCAAGGAGCTGCGACACGAGTTCGCTTGCGTGCTGG
TTCTCGGGGTGCTCGTCAGCTGCGACGCGTCATCGTTACCAGGGGTGGGCTCGAACTGGATGCGGGACAGGTGCAGAATGGCCGCCACAATCTTGAAGAT
GCTCATCTGGTCCTCCTTGGACACACTCATCGTGTCCAGACACGACACCGTCTGCTGGAATCTCTCGGCGTCCTTCAATCCCGCGCTGACGTCAGTTCCA
TTGGCGAGGTCCTCGTCGTGCGGCTTGATGAACGGGAAGTTTTTGGCCTCCATGCCCGTGACCTTCACCTCCGTCGTCACGTGCTCGGGGGCCGCCAGCA
GCTGGTAGAAAATATGGTAATTGCGCTCGCCCAGACCTTGCAGTGACACGCGCGACTTCTCCAGCAAGTACGTGCGCGAGCGGGCGCCAATCAAATCACC
CAAAGCGTCGAACTGCAACTCGGAGAATTTACCGAAGCGACTGGAATTGTCGTTGCGCGACGTTTTCGCGTTACCGAACGACTCCATCAGCGGGTTGGCG
TCCAGCACCCGCTCGATGATGCTGGCCTCCTTGGCCTGGGCGTCAGATGTTGAGTGGCTGCCGGCCGATGCCAAGTGAGACATTAAAATCTTGGTCGTCT
CCGTCTTACCGGCGCCGGACTCGCCACTGACCAGGATACTTTGGTCCTCTCCGAACACGCGCATGTGCTGGAAGGCCCCGGCACTGGTCGCGTACACGTG
GGGCGGCAACTCGCTGCGGTCGCGCTCCAGGTACTGCTCTTGCAGCTCCTTGGTGTAGATATCGAGCCACGAGTACTGAAATAGCGACATATTCGCGTTA
GATAATATCCGGATATTCCGCATTGAAAAGGGAACAAAATAGGATGTTCTGACGTACCGGGTTGACTGCAATGCAAATGGCGCCCGTGTATGTATAGGGA
TTTGACGCAAGAAGCGGTGCTTAAGGTTGAACAGGATGGCCGGCTCGTGGAGGTAGTTCAGGGTCACCATGTC