Description :
From Genome Similarity Track
Location :
scaffold_758:6680- 9922
Transcript NameFunction/comments
g10163.t1 conserved hypothetical protein
g10164.t1 glutathione S-transferase, putative

Sequence
3242 bases(100 bases per row)
CCTGCCATGACGTCGCGTACCGTGCTGCTGCTTCTGGTGGGTTGCCTGTGCTGCGCTTGGGGCTTGGCTCTTGCACAGGATGTGAACGACTCGCCGGTGC
TGGACGTGGAGGCCGAAGTGGTTTGTGAGGCGTCCACAGACTGCTTGGCGCTGGGACTGCAGCACAGCACATGCCGCGCCGGCGTCTGCGTGGATGACGT
GCTGTTCCCGCTGTCTAGCGAGGAAATCGCCGGCTCAATTGGCGCCTTTGTGGCCAGCGTCCTGGCCGCCGGCTCCGGTTTGGGCGGCGGTGGTCTCCTG
GTCCCCCTGTACATCATGCTCATGAGCATGTCTTCGCACGAGGCCGTTCCGCTGTCCAAGGCCACGATCTTCGGCGGTGCCATCGCCAGCTTCCTGCTCA
ATGTACGCAAGCGCCACCCGCTGGTGCGCAGTCGGCCGCTAATCGATTACGAAACGATGCTGCTCATGGAGCCCATGACGCTGGCTGGCACCATCATTGG
CGTTAACATGAACGCGGTGTTCCCGGAATGGCTCATTACGGTTTGCATCGTGTGGCTGCTGACTAAGACGGCCTTGAGGACGTACAGCAAGGGCAAGAAG
ATCTGGAAGGAGGAGGCGGACGCCGACAAGAAAATCGTATTTGACGTTGTAGCGTACTGGCGGTTGCTGCCGTATGAGGCGAACTTCAAGCAGTTCCAGA
TTGTGGCTCGAGCATATCTGAAGTGGAAGAACTACAAGAATCCGGAGAAGGAGCAACTTCGTCTTAAGATATTGGCCGGCAAGGTCAGCAGTGAGGGGGA
GCACAGCTCGTCAAACAGCACGGAGGCGAGCACCGAGGAAGAGGGTAGCAGCGATGAAAATGAGAGCGAGTCTCTAATGAGCTGGGGACTGCAGGACAAA
CGTCCGGTGAAGTTCCTGTCGGTGGAAGAGATCGCTAAAGCGCGACGAACAGTCCCGATGGCGGATATGGGTGTGCTGTTCCTGACGTGGATTGGTCTCG
TGCTGTTTTCGATGGCGAAGGGAGGACACGGCACACCCAGTGTTATCGGCTTGTCCTGTGGAAGCATCGGGTACTGGTTCTTAATTGTCGTTTCGTTCCC
GTTCTTCGTCAGCGTAACGATCTACTTTGGCATGAAGATCAGCCGGTTCCATACGATGTTGAAGGCGTCCGACTACACCTATGCAAAGGGCGACATGGTT
TGGACTAAGCACGCTGTCGTCAAGTACCCTGCATTGTGCACTGCTGCGGGTGTAGCTGCCGGTCTATTGGGCATTGGTGGTGGTATGGTGAAGGGTCCAC
TGCTGATTGAGATGGGACTGCTGCCTCAGGTGTCTTCGGCCACGTCTTCATCCATGATCCTGTTCACGTCTTCAGCCACGACAATTCAGTTTATTATCCT
GGGCACGCTGTCGGTGGATCACGCTCTGTGGCATGGTGCTGTGGGCTTCGTGGCTGGACTCATCGGGCAGCTGGGCATGTCGTACTTGATCCAGAAGTAC
CGCAAGGCGGCACTGGTAATCTTCCTGGTCGCCATCTTCATCGGAGTCAGCGGTCTCGTCATGGGCGTGCTTGGTGCAGTCCGCATGTCGGAGATCGGCT
TCGGAGGATTCCGCTCGCTCTGCCTCAGCGGCTAAAACCGCTGAACTGGCTGCTGCTGTCGCTTGTTCAATACCACCAGTCACATATCATAACTTAACAT
GCACACGGGTTTGTACTTCATCGGCGTGTTTGTTCTTGCTGTCAAGAAAGAACTGACACCGGAATCTATGTGAGTCACACAACTTCAGTTTAACATAAAG
TTCGGTGGCACTAGTACTCGATGACGTCATCAAGATCGTAAATGTAGTAACATCTAGTGTGAAATCGGGTCGAACGCAACGGCTCACTTCTACATCGAGC
CGAGAGACCATTCCGCCTCTTCAGTCTTCAATTTGCTCCACGTGTACCACGCCGCAAGCCTTACCACTCAATAGAGATCCTGTCCAAGATGAGCGCCTTC
CCGTCCATTAAGCTCACGTACTTCGCCGCCGCCGGTCGTGCCGAGGCCCCGCGTTTGGCCTTCTACATTGGAGGCGTCCCCTTCGAGGACAAGCGCATCA
ACCACGAGCAATTCGTTGCTATGAAGAACGCGCTGCCCCTGGGGCAGGTGCCGATCCTAGAGGTGGACGGTGAAGTCTTCACCCAATCGCACGCCATTAT
GCGCTTCGCCGGTCGTATGGGGGGCCTCTACCCGGTCAACACGCCCTACCTGGCACTTAAGATCGATGAGATCCTGAACGCTATGGGCGAGATCGAGGAG
AAGATGGGTCCGGCTTTCCGTGAGTCCGACGCGGACAAGAAGAAAGCCATGCGTGAAGAGCTGGCCACCGTCACTATCCCTCGCTACGCCGGTCTCTTTG
AGGCACGACTCGAGAAATTGAAGCAGATCCCTGCCTTCCAGACCAACGACGTGTTTATCCATGACGTGGCCATCTACGCGTTTGTGAAGTTGCTCCGTGC
CGGCTACATCGACCACATCCCCACGACGGTCTTGGACGGCTACAAGCTGCTGAACGAGGCGCACGACAAGGTCGCCAACCACCCCAAGGTCAAGGAGTGG
TACACGCTGCAGCACAACGCTCCCAAGCTCAAGCTCGTGTACATGCCTCACCCTGGTCGTGGAGAGCCGATCCGTCTCGCTTTCTACATTGGCGGCGTCG
AGTTCGAGGACGAACGCATCACACGCGAAGAGCTGGCCAACCGCAAACCTTCGCTTCCATTCAACCAGCTTCCGGTGCTGGAAGTGGATGGAGACGTCAT
CTCCCAGTCGCTTGCGATCCTTCGCTACGCTGGATCGCTTTCCGGTCTTTATCCTGTGACTGACCCGATTGCTGCCTACCGCGTCGACGAGCTGTTTGCG
ATCCTCGACGACATGTTCAACTTCCCACTGTGGGGCGCCTCTCACCGTGAGAAGGACACGGAGAAGCAATTGGCAATGCGCGCGGAGCTGTCCAGCGGCA
TGGTGCCTAAGACGCTGAACTTCCTGGAAATCCGCATCGACAAGAACAAGGGACCCTACGCTGCAGGCTCGAACCTCACCGTGGCAGACCTCGCTATCTA
CGGCGTGCTGCTCGGCTTCAAGAACGGCGCGCCTGGGTTTGCGAAGACTATCGCCGACTCGTACGAGAACTTGCAGCGCGTGTTCAAGTTGGTGGCCGAG
CACCCGAAGGTTGTCGAGTGGAATGCTGCGCACAACCAGTAA