Description :
From Genome Similarity Track
Location :
Scaffold_66:6680- 8725
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17329hypothetical protein

Sequence
2045 bases(100 bases per row)
GTACACTCGGCGCAGGTCCTCGTCATCATCGATTTCAGACGTCTGATCTCCGAGTCGCTACTGGTTTCAGCAACATGGACCGCTTAACCACACGCGTCGG
TACAGTCGCGTTGGGAGGCATCTGGCGAGATTTAATCGAGCCATATACCGACTTGATCTGCCGGGCCTACGTACGCTGGCGTGATCGCAACACCACCTCG
AGGGCATCTGCATCGGGAATCCTAAGAATTGCGAGGTGATCAGCTAGATCCCGGTCGTCCAGCGTCTCGATGAAGTGATCAACATGTTCACAGCAGACTT
GCAACGGACCATCCTTGACTTGGATTCGAGCGCGTAGATCCGCGACATTGAGGCGATACGATACTCCAGTGGCGACTCATCGGGTCGTTTCCGCGCATGT
TAGTAATGCCTTGCGACGGAAACACTGTGGCCGCAGTATTCCGTCTGAAAGCTGTGGGGCAAGTCCTTCCACGTGCTGCGGGTTGTTCGACTTAGCTGTC
GATACCAATTTCGAGCTGGTCCGGGGTGTCAGCGATGTCTGAACTGAAGGAGTTCTCTGGAAAGGACGGCGACAACGATCGAGCCGATCTTTGTTGAACA
AGGTTAAATCAGCCTTTGTGCGAGATCAAGCACCAGATGAGGAGAAGTGCCTTGTCTTTGGCGATCTCCTCGCGGATACGTGGGACAGTCGTGGTCTTCG
TAGGCGTCTTGAAGGCGTCGTAGCGACGGCAGCACGTCGATAACATCAAGATCATTGGGGTCATAGTCGTTTGGAAAGAGATGGTGATCTAGAGATCCAA
CCGACTCCATCTATACGTCTTGGGCTCCAGTGGGTGTTGGATCTTCAGGCGCCATCGCTATCCGCTGTTCTTCAAGGAATCACCCCATCACCGACTGAAA
GAATGACTCCAGCTTCTCCGGCGGAAAAACCGCGTTACGCTTGCGACAGCGAAGCCTCTCTCAGTGGGTGGACTTGCAGCCTTCTGGGCGGGTCGATCTC
GTAGCAACGCGGTTCCGGATGGGCCTAGAGTCATTCATGGCGAGTCATCGACACTGTCGGTGTTCACCTCCTCTGTTACAGACTGATAATGGGAAGACGA
CTCTTTGTGATCGTCCCTTGGGGAATCAGGATGGGGTATTTTGCTCTTGGAGATCTTGTGGGCTCCACCCACCAGCGGCTTCAACATCTCGAACAGCGTC
CTGGGCGCAGCACTGATGACTTCTTCGCTAAGGTCGAGCAGATCATTGGACTCAAATGCTCCAGCAACAATTCCGGACTCCTTGAACAACCGTAGCCTTG
CTTTTACGTTGTCCAACGTATTCAATCTCAAGGCCAGTTCAGATACACAACCCTTCAGATCACCGAACAGCTTCGGACGGAGGATGTGCATCACAGCGTC
CTCAGTTAGAAACGTGTGAAGCTGCTACTCGTGATACACGTTCTCGAGATGTTCATTCGCCCAAGCCGACATACGATCGATGCGATCGTCGATGTCCGAG
TCTGGTGCTTTCGCTAGGACTTCGATCTAGCTGGCTTCTTCTTGACGGTCGATCTTGAGCTAGAAGGTTGCTGAGACAAGACGTTCCCGGCTTTCGGTGG
ACTTTCGTCCAGCGGGTTCTGATGCGAATCACAACTCGCAGGGGTCCCCGAAGGGACCTGGGGAGGAGGTTGAGGTTTTTCTTCTAGGTCTGTCGCCAGA
CCTCCCTCTGTTCCGTCGGTAGAGCTCCTCTTAAAACTCTGCCGATCTGTGGATCGTTCTTGGCTTAGCGAAGTCAACGGCGATCCAATATCCGCCGACG
CTTCGTTCCCTAGTCCAATTCCAGCTTGGACTTCTTCATCTGGGGATTCACGGTGATATACTAAGGCACCCAAAGATCCGGGCACGCGCACCACTGTGGC
GAAGTGGTTCTGCGAAAATTGCTGATTGCTGAGGTCCTCTTGCCGACTATACTCCGATCTTCCGTGAAGTTATAATGCTCACCTTGTGTACCCGTCGGTG
GGCCGATTCGCTCTTTGGGTGATTTTAGAAACGACGCTTGGGCTG