Description :
From Genome Similarity Track
Location :
Scaffold_1834:668- 3323
Sequence
2655 bases(100 bases per row)
AAATGCAACCATACCTGCACAGAAGTCCGTTATCACCACGATTCAAACGTTTAGGCAGGCTCACAATGTGCCGCTGTTGAGCCTCCTGCAGTTCTTGCAC
CGTAGGTCACACGAAAGTACCGTCACTAAATGGTCGAATACGTTGGCGGCGTCTATTTTGGTCTTTAGGCTCGTTGTCTTCACGCTGCCGTCTCAACGTC
ACACGCTTCACCGCCATATTTGGCATTCCACTCGCACAGGCCCACCGAGAAACCATGTCGGCTCAAACGTTGCTGGTTCCGTCGATATGCTCGATACTGT
AGCGGTATTCCATTAGTTTCATGGCCCACCTCATAAGTTTCCCGCGTACGTGCTTTTTAACTTCGTTGCCAGGTGCAAATACATGTATCAGGTTGCAGTG
GTCGCAGTACATGCGAAAGCCACCAGGACGCAGCAACAGGTAACTGAGCTTATCACATGCCATGATGATTGGGTATGACTCCTTTTCGATGATACTCCAG
TTTCTCTGAGCACCAGTGAACGTACCACCGAGACAAATCAATAGTTCGTGCTGCTGGTCCTGAATCTCAGCACCTTGTTTCCACTCAGGCACTTGCGAGC
GATTACAGACCAGCCCACATCCGAGGCATCAGTCAGGAGAATCATTTCCGCGTCCGGCTTCGGGAACGCGAGGCTAGCTGACTCAGCTAGAGCTCGCTTC
ATCTCGTCGTATGCCTCGCGCTCTGACGAGGTAAGTGCGACTGGGATGTCCGAAGCTGCACGCTTGGTACGTCTCGAGGCTTTAGCCATCGCTTGATCTA
GTGCATCTTGCAAAGGGCGAGCGAGTCGTGCATAGTCAATGATACTGTCCCGCATCCAGTTCGTAGAACACAGGGATTGTTGCAGCTCGCCTGCATTCGT
TGGATACGGCATACTTCGCAAAGCAGCAATTCGCTCTGGGTCATGTTTCACTCCTTCCCCATTGCTTATCTTACCACACCATTTTACTTCTTGCTTGTAC
AGGCAGGACTTGGCGGCACTCAGCTTAAAACCGAACTTTGCCGTGAGCTCAAGCAGCTCCTGCAGTTTCTCCAGGTAGGTGTCAACATCGGGGGCGTACA
GCAAGAGATCGTCAATCCAGACTAATAAATGCTTGTACAATAGTGCGGCGTAGCAACGCTCCATGGTGGACTGGAAGTACAGTGCTGCATCTGCGCTGCC
TTGAGGTACGCGTCGTGGAGTGTAGATCTTCCTGTGCGTCATGTACGATAGGAGCTCTTGACACTCCTTGGCCAAAGGTAGCTGCCAATAACCTTTTATG
AAATCGAAAAGGCCAAAGTGTCTGCTGCCCCGTACATTTTCCAAGTCTACATGCAGGTTGGGCATCACTCCTGCCATGGGCTCCGTTTGCGCGTTCATTG
GTTTGTAATCCACAGTCTGCCGGAACTCACCACCTCCACGTTTGCGTAAAGGCAATGCGGCACAAGCCCAACGACTCGTTGGGTTTTCATATACCCATCC
AAGTTTGACAAGCATGTCGTTGAACGACTCCAGAAACGCTTGATACGCTGGTGCGTACTTCCGTGCTTTAGCTTTGAACGGCCTGCAGCCTGCTTTCATG
TGCACGCGCATTGGTTCTACGTCTACAGGAGGGTCGTCACCGAGTACCAGCCTCCAAACGTCGCATAGACGATGATACGCAGGCGTTCAACTTTGCTCAC
GGGAAATCCTTCCTGCACTGCTCGTTCAATCATCAACTCGACAGCTTTACGAATATCATCATCCGTATTGCTGCCATTCGCCACATCAGGTTCCTCATCG
TCATCCTCTCCATCATCTCTACTTGGCACTGCCAGAAGCTCCAATTGTCTCCCAACATCAATACCAAGCATCTTCAATACATCGTTCCCAAACAAAAACT
ATTCATCATCATTCTCGAGGATTAAACACGTCACCGGCTTGTTGATACTCACCGGACCTGCGGCTGTCATGAGCGACAAGCGCAGTTTCGCATTTTTAAT
GTGCCCACGTCTTCTTTCCTCCAGGTAATTTGCACTCGACGGGATTTTGCAATTTCATCACTTCACACTGCACAGCATGCTCACCAATTTTTTGTAGGGT
CTTCGAACTGATAATCGATGTATCAGCACCAGAGTCTGGACAATACTCCACATCAACAACGCCATTGACACGCAAAACAACGGGGTTTCCCAGCCCCACT
GGATAGGCACTACCTAATTCGCTTGAGCATTACGGTGCTCCCCAGGTTTCGGCTTGTGCCCCGCCATGGAGTTGCCTTCGTTCTTGTTGGGGCAGTCGGC
CCGTTTGTGCTTGCCGCCACAGGCCCAACAACCCCACTTCGATCTTGTCGCACTCTGCTCGGAACTCTCCTGAAATATCGGCCGAGACGCTGGTTTAGTG
TAGTTTCCCTGCGTTGCCCTGGCGTCTGACACCATCCGAGCCTTCTTTACAGGTCGGGCCGACGCCAGTCGAGACGACTCTGCATCAGAAGGTCTTCTCT
TGTTTCGTTTCAACGCCAAGTCTTCTCGATCAACCTCCAAAGCTTTCTCGCTCACGATCTTGAAGAGCACGGAGACGTTCGACTTGGCCAGAGGTAGGCG
AAAATCGATTTCATTTTTCACCCTCACCTTCAGTTCACTGGGCAGGCAATTCAAC