Description :
From Genome Similarity Track
Location :
Scaffold_1631:668- 2201
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1631-fgenesh-gene-0.0Phosphatidylinositol-4-phosphate-5-kinase (Pi-PIPK-D8/GPCR-PIPK)

Sequence
1533 bases(100 bases per row)
CGCTGAAGAGCACGTAGCACCCGAGCACGAGCGTCCAGTAGCCAAAGTAGCACCCGACGTAGTACTTAAGGTGGCGGTGGATGCGCCGGCGTGTCGTGAA
CGTGTCTGGGAGGCCCTTGGAAAGCGTGTTCCAGGCGCGGAGGATCGCCGCGAGCGACGTACAGTAGACCACGACGATGTAGAGCGCGAAGAAAATTCCG
GACGTGAGCGTGCCGTTGGACGCTGCGTCGACGATCTCCTGGGTCGCGCTGCCCTTGGCGACCGCGTCCCGAATCAAGTTGAGGTGGTCGTCGCTCGAGC
TCATCCAGCAGAAACCGAAGAGCGCGTAGTGCGTGTCAAAGTGCGAGATCGTGGCGCACACGAGGCTCCAGAGCCCGCCGGCGATGTGATACTTGGTCAT
GTGGCCCTTGGAGGCCGAGAACGGGTTCTTGAGCGCCATGAGCAGGTCAATCGCGAAGATGAGCATGTACGTCTCTTGGCCCGTGAGGAAGACGTCGACG
ACGACGCCCATCTGGGAGCACTGGACCGAGGCCGAGGACCGATCGAGCAGGTACAGGAACTGGTAGATCGCGCCGTAGACGCTCATGCCGAACATGATCC
CCGCCGGGTGCTGCCGCAGCGCGCGCACGTAGAGGTACGTGGCGATGACGTAGAGGCAGCCCACGAGCGACGCCACCGAGGCCATGACGGGCAGCATGGA
GCTCGCCGCGGGGCAGTCGGCGGTCGAAAGCGGCGAGCTCCCGCGGGCGCTCGTCTCAGTGTCAGCCATGGCTCGCTACACACAGAGGAAAACAAGGTAC
GTCTGCTCACTCGAAGACGTCGATACAGGGAGGGAGAGATACACTGGAAGGAGCTGCTGGACACGCGAGATGCTGGTTAAAGTACCCTGTTCGGCAGCAA
CAGAGAGAGAGAGAGCGTTAGCCGCCGACGCATACACGTGTACACACAGCTTGTCGTCTGGATGAGCGTACCGTGTGGTTGTCGTGAGACCACAAACGGG
TGGGGGTCGCTATTGCTGTGGCGAACAAATGGCGGTGTTGCGGTGGCTCTCAAGATCGCCTGGGCCTCGGGTGCGTTGCCCTGCAGCGTCGAGTTTCGTT
TCGCCTGCTTCTCCTTCTCTTGAGCTTGGGGCGTGAGCTCAAGAGCTATTCTTAATTGCATGGGACGACGGTTGACGCCGGAGTGTTCAGAGCGCGGAGC
GTGCGCGGAAGCATGGGCGTTTTGGCTGGGAGGGCCGCCCGTTTCTTCCTTGCTTTTCTATATTAGTGGTGGTGGGCAATAGAGAGACCTGCTCACACAA
CCCAGTGTCGGTGGCATGCGGCGAGTGGGGTAGTGTGCTCTGGATCTCTCGGCATTGCTTGGATCCCCATGCGCAGCTTCCATTCAGGAACAGCAACGGC
CGTGTGCGGTGGCGATGCGGATGCCGAGCAAGGTGTGACTGGGAGCTCTTCACACGTCACATGTTTCCAAGTTAGTGTGGCTGTGACTTGTGTGACACTC
CATATAGTGTGGCTGCGACGTGATATGCAATAG