Description :
From Genome Similarity Track
Location :
scaffold_347:6678- 8379
Transcript NameFunction/comments
g7503.t1 hypothetical protein PHYSODRAFT_332774

Sequence
1701 bases(100 bases per row)
TGGGTCACGCAGCATCCGGATTATACCAGTCACGTATTGCCACTGACAGGGGCAGCTCAATGCCAACGACTGTGTAAATTGATTCTTTCCGAATTGAGAC
TGGAGCTGGATGTCGGGAATTCGACTGGAACTCCAGTTTTATTAAGTGCAAGGGAGAAATTATTGCCTCAAGTGATGAAAGCGGAAGGATTTACGAATGT
GGTTCTGTACCCATTACATCGAGACGAAGCGAGACGACAGTTGACGCGCCGATGGGGAGCTCAAAGCTCGCTTGCGTTGCCTCCTTTAGAGGATATTTAC
GCGTATTTTGGACCGAGAATTGCCATGTATTTCGCGTGGCTAGCGTTTTATACAAATGTTTTGGTGCTGCCAGCAGTGTACGGCGTTGTGGTCCATGTGC
TTGGACTAGTGAATCTGGCACCGAGTTATACGGTTCACTGCGTTTTGGTTGCTATCGGTACGTCGCTCATTGCAGATATGTGGAGGCGGAAGCAACGGGC
AGTGGAGTTTACGTGGGGGTACGACGGCGTCTTGTCGTCTTTGCACTCCACTACCAGACTGCAGTTTAAAGGCGAGTGGATGCAGGACCCAGTGACTGGA
GTGCGGTGTTTCAATTTCCCCCATCATAAACGCCTTCTAAGACAGCTTTTGGCCGTTCCGCTGCTAGTCTCCATGTGCTGCTTGGTTGGTGGGTACGTGG
TTGGCTTGCACGTACTGTCGGAGCGTCTTCGAGCGAGCTACAAGGACAGTTGTGTCCAGGCGTGGGCGGGAGATGAGATCGTTCAAACAAGCGATGGCTA
TTGGAGTTACATTGTGGACAATTGGATTCCCAGCAACGACATCATGACGTGTGCGCTTGTTTCGCATGGACCAAGTGTGATCAATGCCGTGATCATCTAC
ATGATGGACAATTTGTACCAATTGCTGGCAAGAAAACTCACGGAGTTCGAGAATTACCGTACACTTGATGAACACGAAGCGCACCTGGTGGCCAAGCGGA
TGCCGTTCCATCTCGTGAACAGCAACGCTTCTTTGTGGTTTCTGGCGTTCTATGTCCGGCGGTTGGATCGAGTGCGCGAGCGTCTGTGGATTTTGCTGGT
GGCGACGCAGTTGATCGATAACTTTAAGGAGGTGGGGCTACCACTCGCTGTTTCGGTCGGAGGCCAAGTACTTACAGCCGAGAACAAACGACGTCGTCGC
CAGAGCCTCGAGTGTCTTCAGAGCGAGGATATCGAAGGAGTTCCACATCTTCAACTGAAGAAAGCGATGCCTCAGCTGACGGCGAAGCGTGAACGGGTTG
ATGTTGTTAAAGCTGCAACTGAGCAACGACTGGCGCGAGTTCTCATGCAAAAGCGGCAGGCAACGTATCGCGATACTTTTGCAGATTACAAGGAACTCAT
GGTGCAGTTTGGTTACGTGACGCTTTACAGCCCAGTTTTCCCTCTGGCTGCGGCGTTTGCCTGGTTGAACAATACGATCGAGAGTCGATCGGATCTACTC
AAGCTCGTGAACCGACACGGCTACCAAAGACCCATTGCCCAACACGCGCGAGGTATTGGCGTCTGGGAGAAAGTGTTGGTCAGTTTCGCGGGGGTGGCGG
TTGTCGTGAATTGCGCTCTTGTATGGACTTATGAACTGGACGAACTGCTACCTTCGTGGACCGACCTTCAGCGATTTGCTTTCATTGTGGCGTGTGAGCA
C