Description :
From Genome Similarity Track
Location :
contig_120:66778- 70247
Transcript NameFunction/comments
g13940.t1hypothetical protein

Sequence
3469 bases(100 bases per row)
CCATGCTGACGAATTCAAGTTGCTCGCTTGTCGCGGTAAACGCGAGGCACTATGGGCGTACTTCAGAAAGAATTGGTCTGCGAAGAAGGAAATGTGGGTC
GGGGCGTTTCGCATGGATTTGCCCCACTTCCGAAACAATACGAACAACAGACTGGAGAACTTTTTCGGGAAGCTCAAGGCTGATCTCGACGGATCGTTCT
CCATGAAGGACTGTCTGCAAGCAATTCTGAAGTTCCAACGCCGCAAAGAAGACGAGTACAACGCAAAGGTCATGCTGCCGGGGTCCACGCTAAACGCGAA
CTACGGAGAAGAGATGAACCAATTGTTGGGAATGACTTCCGGCTGGCTTGCCGAGACATTCTTTCCTGAGTATCAATTCGCGACTGACCCTGATACGATG
CCTCAGTACACCTTTGAAGAGCGACAGCATCTCGTGCAAGTCTGTCGCGACGGACGTGTTCCCCGAGTTGACACGAACAAGTGGCTTTGCGACTGTGAAT
TCTCCGTCACTATAAAGCTGCCCTGTCGTCATGTACTTCTGTTCCGGAAGCATCTTGGAGATGTCTTCACGATCCCGTATTCGTCGATACATACCAGGTA
ATGGTCATGTTTTGCCGTGTATTGACCATGTACTTGATCCCCTGTATTGACCACGTATTGGACATGTATGACCCTTGTCTTTTTTGGTTAGATGGCTGCG
GACGTCTGCATTAGACGATGAGATCGCCTCTATCGAGGTTCCCATCCGCGTTAGCACATGCCGTGATGATGTGAAGATGAAGAAGCAGATGGCTGAGCGG
GATAAGTACAAGCGCGCTCAAGAAGTATTCTCGCGTATTACCACGGAGCTCACTGACTTCCCCGATGTAAAGTTTGAAACAGCGATGGGAAATCTGGAAG
AATGGTGTAGCAATTTACGTCAAGGAAACTTGTCGCTGCCGGTGCAACCTTCGCAAAGCGGATCTGATAATGAGTTAGCGCCAACACAAGTAGCTGCCAC
ATCTGAGAACGGCGCGGTGGTGAAAGACGAACAGGTCCATGGCGGAATTTGTGAGGACGCGGCCGAGCAATTAAAACTGAAGCCCTTCAACCCACGAGCA
CCGAAGTCAGGGCGACCGAAGAAAAATCGGGCTGCTACCGACTCGAAACGAAGCACAGAGCGGAAGGAGTACAACCAAGGCAGCAAATTGAGACAACTGC
TTAGTGCGAAATATGTGGTGGAAATCAAGATCTATCTCGGGACCAACAGGCCTCCTCTGAGCGAAGTTCTCTCGTTTTTAAACACGGTCGAGGTCCGCTT
CCGTGGGTATGCCAAGAAGAAGATGACTGCAACGCTGAGCAATTTAGAGCCGGACCCAACGCCAACATCGTTCCGACTTCCTGAGGCTATGGTAACGGCA
GCTCTCATTAAAGCAGTGAAGAAGGAAGCTGAAATGCAGGACGTTGGGACGGAGGTGGATCTTTGTTCTCCCGTAGATGGAACAACCAGTGTACCGAATT
GTGCTCGGTCCACGTTGAGGGGGCCGGTGACTTTTCGAAGAACAGACTCGAGGCCATGAAATACCTGTGGAACATGGCCAATGCCTGTTCTCGTGGAATG
CAATACTACTTGTGGCTCATGAGCGAGGTATACGTCCATTTCTCGGATGAAGGATCACAAACGGTCGCAACTGAGATCGCCAACGCCTGAACAGACGACA
GAATCTCAGGATTTAGCTTCGACGTGCACTGGGCGCACATCTACTGCGTGTGGCCCGGCGTATGGTTCAACGATATCATCATTCATGCTTTTCTGGAAAC
GCTTTCGCACAAGTACAAGAAAAACAAGACGATTTTCCTTCCACAGCTGAGCAACCCGGCACCAGAGAAAGGTAAACGCATTCCCCAAGCCACGCTCAAC
GCGCTCGAGACGACATCTGAAGACTTCGTCTTCATGCCGATCAATTTGAACCGATGCCACTGGGCGTGCATCTTAGTAGACATGACGAAGGGAACACTCT
TGTGCTACGACAGCGTGGATAGCCGTCCTCACCACAAGCTTCTGTCGGAGTTGGCATCGGAGATGGTGGCAAGATCGCTGACCGGGTTCACGCACATCGC
TGTGCACAACCCGTTGCAGAAGGATAGCAACAATTGCGGTCTCTTCGTGTGCCTCTTTTTCTGGAAGCGACTGTGGAAAGAGGTAGGGAGTGACTACACA
GAGGAAGGCCTTGCTCGCAGACGCTGGCAGATTCTGCATGCAGTTGTGAACTTCGACAAGGAGAAGAAAGAGGATGCTAGCAAGTAGATCTAAGTCTAAT
CAATGAGCATTGCATTACGGAACATTTTCACTGTCAACTTCACTTTGCGTTTATGTATTGACCAAGTTTTGGACATGTATCGTAGTGTAAATTGGCCATG
TGTGCGGAACATGTATTGCCCAGGGTTTGAGTAAGTTTTGTGCATGCAGATGTTTTGACAGGCCAAGCAATCAACGTTAGTGTACGTGTCATACTGTCCC
TCTTTAATAGTTTAGCTGGCTTCTTCGACATTTAAAGCTGGACAGATTGAATGGACAGGCTTGACCGACAACACCCACGCACTCTCACTCTCCATTATTT
TTTGGCGTTCCGCCAACATGTATCGTCCATGTTTTAGACATGGCCATGAACAGGTTTCTTAACCAGAATTTATTTCCAAATGACTTCTGCTTCCGTCATT
TAAAAGAAATCTTCCGCTTCATTTGAAAAACATGGACGTTACCTGACGATACCTGCCCAATACATGATAAAGTAGGCCTACCCCTTATAGAAAACATGGG
CAGCATCAACAGCCATATTTGTTTCTACGTGGAGGAGCTGCAGGAGACGCTTCGACAGCGCTTTGGCCAAAATCTGTAGAGTTACATCGCTACAAGTATA
TTGCGGTTGTTTTGCTTTGAGCTAGGTTTGTCTAGGAAGATTATGGACCGGCGAGCCCGCGAGACAGTACCTATGGAGATCGAGTGCTTCATGAACAAGA
TGAAGATCTGGTATAGCTACCCAGAGCAGCTCGTTTTTATTGACGAGGCGTCGAAGAACGGGTTGGATGCAACGCGACGCTACGCATGGTCACAGAGAGG
AGAACGAGCAATCGTACGCACACATTTTGCGAGAGGTATTGTGCTTTCTACTCAAAATTTCCATGCGCGATTGGTTGAATCAACCGCGCAGGCAATCGCG
CAAGCCTGTCTAATTGCATTGTTCATGTGTTAAGAGAGATAATGTGTGCACCACACGGTCAAATCTTTGCGCACTCTTCTCGAGCACACTCCAGATTGCA
CCCCACCAACAGCCAGCGGAAGGCAGCAACATGGTTGTTGACGATGAAGAAACCGTCAGTGCTGTTGCAGCAGCCACCACCACCAGCCAAGGAGACGAAG
CGACAAGTTCGCGCGAATTACCGCCAACAAGCCGACGTCGCAGTGCCATGCACTCGACGCCACGGTCAA