Description :
From Genome Similarity Track
Location :
Scaffold_99:66763- 67946
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_99-fgenesh-gene-0.14Amino Acid/Auxin Permease (AAAP) Family

Sequence
1183 bases(100 bases per row)
ATGCGCAGCCGTGGCGTTGTAGTAGACTTCACGCTCGTGTTCTGGACCGCAGAATGGGAAGGCAGGTGCGTTCGGGTCCGCCGGATCAGGGTTGAACAGG
TTCTTGCCGGTCTTGATGGTGACATAGGTGCCGAGCACAAGACATGCGAGGACAACAAGCGAACCAGCGGCCTTCTCCCAAATCGGGATCTGGGACCAGA
GCTTCTTgAaGTAGAACACAATCGgCAGAATGATGCAGCTGATCGAGATGGCCGAGGCACCGACGAAATCGGTAAGGTCGAGGAAGTGGTCCTTCAGCAG
GATCGAGACAACGGTCATGATGGCGATGATGACGATGCGCAGAGGAATGTACTTGAACTCCTGGCCCTTGTACTCGGCCTCCTCGGCCTCCTCGTCATCC
TCCTTTTCAATATCCGCCATCGAAaCGAcGgAGCCCTTCGAGTTGCGgACCTTGATCTCCTCTGCTGGTGTATCAGCcGCGGCGTAGTTGAGGGCCTCAA
TGTCGTCCgTCTTCTTCTTGTGCATGCCCAGGATCATACGTTCAGCGATGTAAAGAGCCGGGTGCACAATGACCGAGAAGGCGATCGTGATGTGCAGCTG
CATAAAGAGGTAGGCGAGAACCACAGCACCCTGATCCGAGTGGAAACCGAGCTTGGTGAGACCGCCAGCACCTGGGAAGATCGTGAAGAGTAGGTTGCCT
GAGATCTGGCAGCCGACGGCCGAGTAACCCGTCGATGCAAGCACAATGAAAAGCACCGAGATGAACGTCAGCGTAACGAAGATGACACGCGGCATGCGCT
CTGGCTGGCTgTGCTGACGTTGGAGCGCAGGGATGACGATACCAGCACCGTAGGCGAGCGAGAGGTTACCGAACGTGATCGCCACCTGCTCGAACGaGAT
GTCTGGAGATGGCACCGTtGGGTGGCCACTCATGCCGTGGATAAGCACAGCCACACCGATGACATCAGCGATGATGGTgCCAAGGCAGCCAGCGAACGCA
GCACCAGCTCCTTCCTTGAGCGTTGGAATGAGGCACACGGGGATGAGGCTGCAGGCCATGAGGATGATCCACGTTGTGTCCTTGAACGAgCCCGGGAAGA
GGCTGGtgagcaggatgccgccagcacAAGGAaTGCACATGGCACCAGCAGGCACACGCCCATCTGCGAGATGACCACGAGGT