Description :
From Genome Similarity Track
Location :
Scaffold_43:66762- 68819
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.49RhoGAP domain-containing protein
Pytap_DAOMBR444snap_masked-pag1_scaffold_43-abinit-gene-0.96MID

Sequence
2057 bases(100 bases per row)
ACCGCATCAGTATGCCGTACAAGACGCGCCAAGAGCTTCATGTGACTTACAATAACGACTTGGCGCGATACGAAGGACTCCCGTGGGCGTGGCGGCGTCT
CAACCATCAGTTCGGCGTGCCACTCGAGGCTGTGCCGAAGCGGCATGTCAGTGGATATCCCTGCAAGATCCCCTCGGTCTTGCAgaTGCTCAAAGACTCC
CTCATTACTATCGACGGGCTGGTGACCGAGGGCgTATTTCGGCTCGCGCCAGACAAGGAGAAGTGCGCTTCTGTCAAGCAATCCATCAATGATGGAACGT
TTGGAGGGTGCGCAGACGTCCATATCATCGCCAACCTCATCAAGGTGTGAGGCGATTGCGAGAGGGAGGTGAATCGACAGGCTAACTCCATTGTGCTTCA
TCCAGGTGTGGTTTCGTGAACTCCCGGAAAGCCTGTTTAATGCTGTCCCCGAGAAGCACATCTATCGGACATGTGAGCTCAAGGTATGGGCATTGGTTTC
ACATCCAAGCGACTGCAGTGAGCACTGATACTGACGTTCAGCAGGATCCTCACGCTGTCATTCGCTCCATCGACGCATTCCCACCGCTGCATGCAAGCCT
CGTGCGGTGGCTGCTCGACCTGATGGCTCAAGTTGCGCAGCATGAACAGCACAACAAAATGTCAGCAaGAAaCCTTGGTACGCTCTCGAGACTTGCGATC
CGCCCcGCCAGTCGACTAACGCTTATACTCCGTGGCGAGTGCAGCCATCGTCATcTCCCCCAATCTTTTCAGTATCGAGAGCGACAATCCAATGTACGCA
CTCACGATGTCCCAGAAAGTGGCCGAGTTCACGTTCGTGCTGCTGGATGCCCGGTTGCGACTTGGCAGTCGGTAGGAAGGGAGGGGCGGCATGGAGAAAA
GGATCAATCATTATTGTATTATACAAAGCAACGTCGTGGATGGAATAACTTAGCCGCCGATTGCAGGCCGCTGACAGAGAGAGAGAGCTATACAAGACAG
CCATAGTCTGGGGAGATTTGCAGGAAAACATCGTCGTCCGGGGCGTCGCTCGACTCGTCAGGGCTGCGAGTATGACAGTCCGTGGAAGTAGATGGAGCCG
CGCTGTTCGGACGTAACGACGATCGACTGGGAAGCCCTGGTCCGGTGGAGGTTCGAAGTGACGCCATCGTCGGAGACCGAGCAAAGGAGAAGAAGTCGTC
ATGATGCTGGCTGCCATCAATCCCGTAGGCACTGGCAGATGCGTCCTCGCCTCCAAAGTCTTCCATTGTTAGTGTGAAGTCGTTCTTGAAATCCTGGAAG
AACGGATCGTACGAGTCGAAGCCAGGAAGACCCGAGTTGGTAGTACTGGCATGTGGCGCAAAACGTACAGACACGCTGGGCATCAAGTCCCCCTGGTGAA
GACTGCCACCCGCACCATGAGAGGCTACTTCTTCTTCCCCAGACGGCAGGCTATAGTATGCCGGCCCTGCGCTGTTGAATGGCATACCGGTGGAGATTGT
GGACGGCCGAGGAAACTCGCCTCGCCTCATGACACTGAGGTGCGCTTTGGGGgAGTCTACGTCAAGCTTCCTGCCTTGCTTGGCGTGAAAAGCTGAGATC
TGGAAGTCGGAGAATGAGGCGACGGTGTCGAGCCGGGGGCTTTGGTTCGACGTACACGACGCATCGTCGTCGTCCAAGTCGTCTCCGTTCGAGTCGTTGT
CGTCACCGTCTTCGTTATCAAACGTTCCTGGTGGCAACCGACCGCTAGGATCAATGCCATAAGTCTCGGGAGAGAGTAGCTTGTCTAGCTGGGCCTGGAA
AACAAGCAGTTGGTGATGCTGCTTGTCGTTCAGTAAGCCCTGGTCGCGGCACCTGTTGAGTTCCTGCAGCGACCGCTTGAGACTTCGGACTTTTCGGTAC
GGCCAGTGCCGAATGCCGATGGCTCGGCAGCGCTTCTTAAAGGCTGTGGCGCGGACGCCAAATTTCTCGGCGGCGATCTTGAGAGGCAAATGGAAATGGT
GGCTCAATGCTTCAAAGTTGCACGTCATGGGCAACGCGAGTGAGGGCGTCGTGGTGC