Description :
From Genome Similarity Track
Location :
Scaffold_183:6675- 8068
Transcript NameFunction/comments
Hyaar_Emoy2812075crinkler (CRN) family protein, putative

Sequence
1393 bases(100 bases per row)
TCTGCAGCTCACAGTTTGGATGCACAAATCCAAGACCAATCGGTCGAGAAGATTCACATGGCACGAGTTGATGGATGGATAGATGATGGACAATCAAGAG
AGGGGGTCTGAGTCTCCAAGGTGCTTGAGAGTTCCCATAAAGAAGCACCCATTCAAGCAGCTTGTTCAACGGCTAAATTCGGACCGCGTCGTCGATCCTT
CAAGCTCGTTCTGGTCGCTCACAAAATATTGGGTGCGATCTCACGCAATTGATAACATTGAAGAAGATCGGAAATCTACGATAGTAGACCTCAAACCAGT
GACCAGCAAGACCCACCAGCTTCGACTGCATATGCAGCATCTAGGTCATCCAATTCTTGGTGACTCGTTGTACTCTCCAGAGCTGATGTACCACTGTAGC
GGAGCTACACAGCTCCTTAAGTCAGAGGAAGACTTAGTGGTCAAAGAGCGATATTAGCTCTAAAGAACTAGACTCGATGAGTCAACAAGCGTAACGCTTA
AGGTCCCTGTTCCAGGGGACCGAACGATTCAGTGAATCCACAGCACTTAGTGCTCAAGAGTAGCTATCTCAGGGAGATGTTGCTAACTCTTAACGATCAA
CGATCAAAGACGCCTCGCAAGGCACGTGTCTTAGGCAAGATCAAAAGGGGAACTGAACTTTATTTACGTTTTTCTCTATAGAATATCTTAATCCTAATAT
TACCTAATCTAGGCACTCACGTCCTAAATCAAGAACTTTCGAGATCTTTCCTATCTCGTGGCTGACAACCGTCAGCCCCTATAAGCTGATAAGATATTCT
ATATCTCTTTCAGTGGGATACCATCCCGTGTGTCTAAGACACAGGGTACCGATTACCCTACGATGTGTAACCCCGTTACACCTTCCCCCACCAGACTGCC
GTTTACCGAAACGGCAATCGAGCTTCGTTCTTCAACGAGGTTAGTGCGCTTGCGGTTAACCTCACGGTAACGCAAAGATTTAGCACAATATCCTCATCGG
CTAACGAGTCAANNNNNNNNNNTATACTCGCACTTACGTGTCATCTCCAAATCAACTTTAGCAATCGTTGGTCAAGCGCTTGCTGTTTTTTCAAATTCGT
GCATGGCGCAAACATAGCGTGCAATGCCTCCCCATTGAGATACGATCCTCCCACAATCTCCACGGGGGTACTCGAATACAGTAGCTCACGACACCTAAAA
ATCTCTTCCGGCGTCCAGACTGGCATGAATAACATCTCGCAGCTTCCCTGCTCAAATTTTTGCCAAATCTCTGCGCGTGGAGACGTGACAAGAAGGGTCT
TCGCTACGTAGAGAGATGGTCTAACGCCATCCACCACGTAAAACGTTTCAAGTTGCACAAGAACTTCAGAGAAATCCGTGTGCGATCCCTTTA