Description :
From Genome Similarity Track
Location :
Scaffold_723:6674- 9367
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_723-fgenesh-gene-0.1Anaphase-promoting complex subunit

Sequence
2693 bases(100 bases per row)
AAGTCCTAGCAGGACACCAGCGTGGGCAGCATGGGCTTCCTCGATATCGCGCGCCGTCGCAGTGGCCGACTGCTGGCTGTCGGTAGCGCGAGCACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGCCGCGCGCTGAAAGTCGGTCGCCGAGGGCCGATGGTACTTGATCCAATACCGCGTCACAATGCTGG
ACAGATCCTTCCCTGGTAGCCGAAGTCCAGTCGCACAGCCATTGTGAAACTGCGGCCAATGAGTCAGCTCCTTGGCATAGCCCGATACATCCAGCGAGAC
TGTGGCGTACGTCGGTGGTGTGCGGCCGGCGAGTGGCAACGCTGGGACGCTCAGTTGCCACGCCTGGTTCTGGACCGTGGCCATGTCAAACGTGCCTAGC
GTCACCATGCCACGCGCGACGCTCAGCGCCATGGACCGCTTGCACAACAGAAGCAGTCGCGCTTGTTGGTGCGCAACAAAATCCTGGTCGGTCATGTCAG
AGGTCTTCTCAAGACGCAGGCACAGCAGGCGATTCGACCGCAGTAGCCGTGCTACTTCCTTGAGCCGCTGATCAGATGGAAAGAGTCGCTGGCTGCGAAC
CATGACATCCGATAATCCGTCCGCGACTTCGCGGGCAGCACCAGAATTTGCATTCAAATCGCTCACCGTAGTTACACTGTGTGGTCCAGCTTTGAGCCGC
GTAGACTNNNNNNNNNNTATTTGCACTCAGATCGCTCATCGTAGTTGCGCTGTGTGGCCCAGCTTTGAGCCGCGTAGACTCGATGAGGCTACCAGAGGTC
GTACCACCGGCCGCGGTCAGCACGTCATCAGTAGCGCTATAGAAGCCCGCGAGGTCGCGACGGCCGATAAACGCGCACACGAGCTCGCTCACATCGTGCG
GAGGGTCTTCGCGATATACACGAATCGCATCGAGTACGACAAATCGGACACCAATGGGCAGATCGTCCAGTGCCAGTCGTCTTCCTACTTCGTCGGTGGT
CAAGAACTCCATGAGCTCTGTGAGTCGAGACATGTCATAGGTTCGCGTGCTCATGCGGACGTCCTCGTCGTCGTCCTGATCCTGCGAAAACAGCAACTCG
TACACGCGAGAAACCGCTTCTGTGCGCCACAACGGGTACGAGCTTCCTGTGCCTTCTTGCACAGCGCGTCTCCAGTCATTGATTCCTTGCAATCGAGGAA
ACGCGGGTGATGACACGTGGTCTGTAACTGGCTCAAAGCTTCCAACGCCGCCACCACCGAGCGAGCGAGCGCTCGATGAGAATCCTTGAATTCTCTCTCG
GAGCCATAGGAAGACGTCAGGTGCAGCAGCGTCATCCTCATCGAAGAACAGGGGGATATTGGCTATCGTCGAAGGCGTCGAAGTTGTCCAGGTTTTCACT
TGATCGCTGGGATCGCTTGGCGTGGCGATATTGATGTACTGTCGGGTATAATATTCTGCCAGATGATGCAGCCCCAGTGAGGAACATAATTCGTACTGCA
ACCGAGCCAATTTGACAGCCGCTCGGCCCCGTGCGACCGAGAGCCGCATATCCTCATGCAGTAGATGCAGCGCGGTGAGCATTCGCCCTAGTGTCTCCGC
CGATACATCGATACCGTCCCGTGCGGTGTGGTCCATGAAAGCTATCCCCCTCGGTCGGCTCGCAGTTGACGAACTATTGACAGGAATGCGACCCATCCCG
CCCACCACGCTTCCTTTCTGGATTTCGTACGTTCTCGCAAATTCAGAATGCAATACTCTGTGTATGAGATCTGCATCCTCGTCGTCTTGTGTGGACTCAT
CCTGAGCCCGAGTAGCTCGGGCTTTCTTGGACGCTCCGTGCTCGAGTGATTCGTCATCTGAGAGCACACTTCCCGTCATCTTCAGTATCGTGGCACGCAT
CACTCGCTGAAAGGCCCACCACTGGATATCTTCTGTATACTCGTCTTGCGATGGGAAGCCGTACCGAGCCGTGACCAACGCCTTGGTCGCAACGATCAGC
TTCAAATAGTCCTTAGCCGGCATCACATACCGTAGCACTTGTGCTGCAGCCCACAGGAGGGACGAGTTCTCAATTTGAAGCGGGTGACTGAACCGTCGGC
ATTCCTCTCGCCGCCCTGTTGTGGTTCCCAAGCTCATAGCAAACGAGTTTGAAATCTGACCAACACTTGCGCACAGTTGGATCGAGTCGGATCGTGATCC
ACGATCTGGGAGTATAATTTCGGCAGCGACTTCGCCGGCACTGTGCATAAAGAGCATATCACTGTCTCGGGACGAAAGCAGAATTTCGGTGGCCACGTCC
GAATGATGGCATGTGCCCGTTGGCTCTTCCGCCAGTACTAGTGGCGACGCGCTCGCGCATCGCACGACACGTAGATCGTCTTCTTGCCCTTGAAACAATG
CGTGGTCGTCATCCTCGTCGATACTGGTTCGCACAGGCTTGAGCAAGAGCACACTGAAGCGCTCATCCAAAATGCACAGCCGATAAGCGATCTCATCACC
GGTCGAGAAGGCATCTTCTCCGTTGTTCTCATCTCCACCAGTGACCAGAAAGGCACGCTGAAACTGGCGATGCCTCTCAACTGCAGAAGGAATAGACTGG
CTGTCCGCAATCGCGTCGAGAATGGGCGTCGTCCACACAAGACGGGTTGTAAAGTTTGGCACAATGTGGGCCTTGAAGAACTGCTCCATCATG