Description :
From Genome Similarity Track
Location :
Scaffold_11:66738- 71408
Sequence
4670 bases(100 bases per row)
CATACCCCGCGATCGTTGGATTCCAGGGTATCGCGATCGGGTTCCGCGATCGGCAGTAGATGTGTCTCTTTGGTCCGCCCGAAGCGTGAGCCTGATCAGC
GTATCGGAGCTGGACATAGACTTGTTCTATCATCACTTTCCAAAGCCGAAGGGATACATCTTCCCGGTCCAACTGGGCAAATTTCGCCCTCCTCTGGAGT
CGTCCTGGTCATCCCAGTTGATCACGTCGACAGAGGTTAACCAATTTTACGATCAACAACCTTGGGACCTTTATGATCAAACCATAGACCCGATCTCCTT
CAAGCCTTCCGGCTGGTTCGAAAAACTGGTCGAGGCTTATAAGGTGAGGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGACACATTTCTTGTGGATCT
CCGCTGAGCAGCGTAAAACGGATCCTGAATTGGCCGCTTTTGCGCGAGCGAGAAGGAAGAGATGATCTCGTGCTGGCCCCCGTTGGAAGCGGGTACTGCA
GCTGATTCTTCAAGGCATGATCGAAGGCCTCTGCGATTTGGTCATTTTACTGTACCCCATGTTTCTACACTTTCCCCGTCCGAATGAAGCTAGGGTGTGG
TATCCCGGCCTATCCATGCGGCGGACCAAGATACCCAACCTGATCACTGCCTTGTCTATCGATCACGCTACCGAGCGTTGGAGGAACCAGTTTCGTCCTT
CGATCGCATCCCACCTTGGGTCGTCCCTTCCACGCTTGGTTGGTAAGTTCTTTGATCGCGAGTAATTTACTTGGTCTGTTCCATGGCGCGATCTCTCAAT
ATACTTTCTTCTCATTTCCATTCGATCGCTCCCATAATTCGTATTCCTTCCATCTTTTTCTGTCGTTTCATCTTGATTGCACCATTAAGTCTGCGATCGT
CGCACTCAATTCACATCAATCCCATTTTATCTCCATGTGCAACCTCCGTGCACCCATAACTCTCCTCCCCGTCCATGCACCGTACCTGCATAGACCCATC
CACTTAAGCTCTCCGATCATCGCTATTTTCTGGCGTCTTCTTCGTGCGATTTCATCACCTCAAAACGATTCTTAGTCACCTGATCGCAATCCAACTCCTG
CAACATAGCTCCACAATTTAGATAAGCTTCATCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTATACCAGGTACTGCTTGTGTATTCGGCCATATCTC
GTTTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAAACTCGTCCGCGTCGAGATTACCCTCCCAACTATCTTCCGGCAGCAGTGCTTCATCAA
AATCAAACCGACTCGCCTCATCCACATTCAACCCACCCGTTGGGCATTCTGGGAATGCGCGAACTAGCTTCAGCTTAGACACGTGGACTTTTGGGAATAG
CCGGTACGGCATGCCCGCGATGTCCAACTTTACGGCGTAATCACCGCACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCTAGCTTTTGAGCA
TATCCTTCCTTGACTCGATCCAGATATAGCCAAACTCGCGACCCGCGATCGATATCCAATAAATCTCGATCTTCATTATGTCGATCGGCTCGACCTCTGA
TCGCAACCTCCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGTATACCATATCTCCATCTTCGGGCATCTCGATCCCGGGGTTTAGT
GCTTCCCAACGGTAAGGTTTCTTCCTAGATCGATCTTGGGTCCCAACCGTGAATCAGGTAGAACGGTGTATCTACTCGAATTCGATCATGAGCGGTGTTG
ATCGCATAAGTCAATCGCTCTGCGTATTCGTCCTAGTCCTTTTGATTTTCATCCATGACATACATCTTGATCGATCGAGTCAACGTCTGCACCATGCGTT
CGGCCGTACCATTAGCTTGCGGTCTATACGCCATAGTGGCCCGTTGTTTTTGTCCTGCGATCCGATTGAATGGTGGGAAGAAATCAGACATAAGTCTCGG
CTCGATCATGGCGTATCGCCTCACTCGCACCGAATCGTCTGAACACGCACTCCTCGTAATTTTCTGCGATCGTCTGCGCAGATCTGGACGAGCTTGCCTT
TGCGATCACATATCCCGAGAACAAATCAACCCACAGCAACAGCTCGGTGTTTCCTCAAAGGATCTTGGCAACGAAGGGATGTGATCCATAGCTATAATCT
GAAAAGGGTACGTTGATTGCATATTACCAGGTGATCCGCTTCGATCCTCCGGCCATCCTTTTCCCGTTTCACAATCTACACACTCTCCCACATACCGCTG
CACCCTTAGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCCTTGATAGGTACGGTCGATTCCTTGGTGACCACCCTCCAAAATTGCGTGGTAGTGG
CGCAAGAAGTCTCGCTGTAACTGTTCTGAAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGAATAGCAGCC
CACTTTGGTCTACTTCATAGTCCGGTGCGATCAGGGTGCATACCTTAGCTTCAGCTGCCGATAATTTAGCTATGTCTCCAACCAGATATATCTTCAAACT
AGGTATCCAGTTTTCTTCGTCTTGTGCTTCGTTAATACGACCAATCCGTATATGCTGCACAACCTCTTCCTGTAAAATCCTGGGCTGACATCGTCTTCTT
TGGGCTGTTCGAGTGATAGCCGCAACTTTGACCGCACGATCAACTCGTTCTGGTAGTAGTAATTCATTTAACCGATTGAGAGTAATCAGGTCCTGACGCT
CTTGATCGGAAACTACAACTGTCCCTTTCTCTTGCCGTAGAGCGACACTCGCCAATCGATCTGCACTCTGATTCCAGTCCCGCTTCATGTGCAAGAACTC
GTGGGATGGCCACGATCGTAATCTCTCCATAGCCCTATGCCTCAATAACTGTAGTCCCGGCGCTTTACAGTTGATTTCTCCTCGCATTTGACGGATCACC
AAATTCGAATCTCCGCAGATAATCACTCGTCCCCTTGCCTTATCGGCAAGCAAATCGAAACTATGGAGCAGCCCTCGGTATTATGCTTCATTCACGGTTA
GATCAGGGATATACTCGGAAGCAGTAGCCACAATCGTCCATTCCGGCAGTTTCCATATAATCGCGCTGTATGCCCCACCCTTCCTTTTCACCCTGGCTGA
TCCATCGAAATTGGCTACCAGCAGGTTTTCATTCACACCTACTGTGGATGGTGGCATGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGATGATCGCAATC
AATACTTCATCTACTTCTTCACGAGGTGTTATGCTTGCCGCAGCATGCCGAGTATTTCATCTTCTCCCTTCTCAGATCGCCTAATTTTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATCAGGTC
TTACAGCAGAGGTAGGTTTTGGAGCCTCACTCACGTGGTTGATCTCGTGGAAATCTGCTTCACGCAATTCGTACAACACTGATGCGTAAACTGCGAAGTC
TTCAATGAATCTACTGTAGTAGTTGAGACTTCCCAAAAATGACTGCATCGCTTGCAGCGTCCGAGGGAACGAGATGTTCACCAACGATCCCAGATCTTTC
GGATTAGCTTCCAAACCTGCGAGCGAGATTTGGTGCCCCAGGTATTCAACCTTGCGACGTCCCCAAAAACGTTTGTCCAAACTGATCGACAAATTCCACT
TATCACACACCTCCAATAATATCTCCACTTTCTCATACAGGGCCTTCCACGACGTAGCTGGTATTAATATGTCATCAATATAAGATCTTCGACCCAACAC
TGATGGTTTTGGATCAGTATCTGGTTCACCATCAGTGAAGGCATTGATCAACTTCGGCGATCCCGCCGTGGTTGATTCGGATTTTACGCCGATTTTCAAA
TACCCATACCGAGCATTATCAATCAAACGTTGGTAAATCTGTGGAGCATTTTTCAACCCTAAAGGCATCCGTAACCACTCAAAAAACCCTGACAGTGTGA
TAAAGGCGGAAATCTCCCTTGCTCTTTCCGTCATCTCCACCACCCAAAAACCACTCGCCATGTCCAGAGAGCAGTACCACATAGCTTTATCCATGTCTTG
CAATAGTTCTCTGATCAGTGGCATCGGATACACCATCAACCTAGTCAGCTGGTTCACCCGCCTGTAATCAATACACAGCCTTATATCTTCTCCGTTTTTC
TTGATGATCACCACTATGGGGGACGCCCATGGTGATGTAGATGGTCGAATGATCTTGGCCGACAGTAATCCTTTGATCAGATCGGCGAGTTTTCTCGGAA
CTTTGGTGCTACCAGTTGGACCCGTTGTGCATGTCACAAACTGCCCCACCCGCCGCAGGAGGTAGGGCGTTACCCTTTCCAATAAGTAGATGCCGGCTCT
TCCGAATCATTTGGCGCAACTCCTCTTGATCCTCGGTTCTTGGGGTGCCGAAATCGCCTACTTGAATATCATCAATCGTTATTTCTTGTGTGGGCGTAAC
CACTTCGGGAAGAACTGCATGTGCTGATCCACATCTTCCGCGAACAACTCGCCGCCATCATGGTAATACA