Description :
From Genome Similarity Track
Location :
contig_124:66734- 72097
Transcript NameFunction/comments
g14037.t1ETI42219.1 hypothetical protein F443_12617 [Phytophthora parasitica P1569

Sequence
5363 bases(100 bases per row)
GCGAGTAACTCGGTAGCTATGAAGAAGGAGAAGCACGGCATGCAGCGGCAGCTGTCGGCGGCGCCTCCCCCGCGTCGACGCGCGCCCTCCAACTACCAGA
CCGTGGAGGACGTGGCAGCCGAGCGCGGCGTGAGCATCAGCCGCCCGCCCATGGACAAGTTCCAGCCGCAGCAGCCCATCGCCGCGTTGACGGCGTCGGG
CCCCATGCGCCCGCCGCGCCCCGGCGCCGACTCGTTCGAGCTGCTGCAGGCCAAATTTGGCTTCCAGGAAGGCAACGTGCGCAACCAAAAGGAGCACTTG
GAGTGCTGGGTGCTCAACTACGAGTCCCGTATCATCGAGGCGGCCGTGACGCCTGTGGACACGGAGAGTGCCATCCAGACCATCCACGCCAAGTTCTTCA
AGAACTACGTCAAGTGGTGCCAGTTCCTGCGCACGCAGCCGCTCCTGCTCGACACGGCGCCGTACCCCGGGGCGGCGGAGCGCCAGATCGCGCTCTTCCT
GCTGATCTGGGGGGAGAGCGGCAATCTGCGCTTCATGCCCGAGTGCCTGTGCTTCCTGTACCACAAGATGGCGGCCAAGCTGGATGGCCTGGAGAAGCTG
CCCAACGCGCCCGACGGCACGTTCTTGCGCCGCGTGGTGCGCCCGCTGTACTCGGTGGTGGCCAAAATGCGCAACGTCACTCCGCAGAAAACGGCGCGGG
CGTCGACCACAAGAACGTGACCAACTACGACGACGTGAACGAGTTCTTCTGGACGGAAACGTGCTTGCACTTTGACGAGGCCAATGTGGCTGGAGCCGTG
AACGCGCAGGACTACAAGTCGTTCAAAGAGCGACGTAGCTTCTGTAACCCCATCCTGGCGTTCTTCCGCATCTACTTCTTCCTGCTCGTCATGCTGCACG
TGCTGGTCGTCATTGCCTACGTGGCTTATCGCTCGGACCCGGACGACACGTCGGGGATCCATTTCTACGCCAACTTTTTCACGTCCGACATCACGGACAT
TCGCAATCACTCCTTCTACTCCATCTTCATGACGGTCAGCGGGTTGCTCGCTGTTAAGGTGGTGCTGGACATTTGGATCGATGGCACACGTGTCTTCAGC
CGCATTATGTACGCGGTGTCGGTGTTCATCCGTCTCGTGTGGCACACTGTGTTCTTCGGCCTCTTCACGGCTGTGAACGCGGCGCCATACAAAGAAGTTG
GCTCGAGCGACTTGCTGTCGATGGCACCCGTTTTCATCGGTGTCTACATGGCGCCGATCGTGATCGTGTCCATTGTGCAGATGTGCTTCCACGGTGTTAT
TTGGAGATCGGCTCTCCTGAGCTCGCTGGATGGGACACGTCAACAGTACATTGGTCGCACGATGGGCCAGAGTTGGGGGAATTTCTTGTCGTACGGAACG
TTTTGGACGATCATTTTCTTGTGCAAGTTCTTGTTCAACTTACAGCTGATGGTTAAGCCGCTTATCGGACCCAGCGTCGAAATCTACGGCGTGGATGTTT
CCGCCGCTCAGCTAGAGAACGGTATCATCGAGTCGCAGCACAACATTGCGTTCCTCGTCGCCATGTGGGCGCCGGTGTTCCTCGTGTACATCTACGACTC
TCAGATTTGGCTAGCTATCGCGCAGGCCATTGTGGGTGCCTGGATTGGTTTCCGTCTCAAGATGGCCACTCGGCACGCATTACAGAGTTCGTGAAGCGCC
TTCAGCAAGCGCCTAGTCTTTTTGACGAGAAGGTGGTGTCTGCTGCAGCCCGCGGTCAACTCGCTATCAACAACAACCCGCTGTCATCGAGTTCTGTTGC
CCCTGATGCCAACAGCCGCCTCCGCTTCGCTGTTGTGTGGAATGAGATTGTGAGCAGTTTCCGTTTGTCTGACTTGTTGGATGATCGTGAAACAGCCATC
CTTCAGTACCAGATCTCAGACACTGGAGCCGTCGAAGAGCCCGTGTTCTTGATTGCTGGCGAGGCACAAGCAGCCGCTGACATTGCCGCCAAGGCTAAAA
CCAAGCGCATGAGTGACGGACAGCTATTCAAGGAGTTGAAGAAGGCAGGCTTACTGGGCTGCGCCAACAACTGTGTTGATATTCTGTTCCAAATTTTACG
TCAGCTACTGGGCCCTGAAGATTCGGAGCTGGTTGGCGTCTTCCATCAAATCCTAGCTGGAGGCAGGGTGAGCGGCGTAGTTAACCTCACGCACATTGGA
TTGGTGCGCGAGAACGTGACTGACTTGCTTGCGAGCATTTTGGACTTGCCGGAGCCAGGTGTCGTTCCTGCTGGTGGCGCCTTTGGCTTCCCGCACGACC
AGGTTCTTATAGTCGTGCAACGCTTGGACGCTCTACTGAAAAGCATTGAGCTTATGCTGGAAGAGGAATGGATGGCAGAAAAACTGCGGAAGTCTGCGTT
TGCCAAGATGACGCCGGACCTTGCTTACCAAAAGGAACAGTTGTTGTCGATCTTTGCTGATCGCATTAGTCAGCGTGACTCGAACTCTCCCACCCGCACG
ACGTCGCCAAGTTCGAATGAGAGTGTGGTGTCGCTTTCCACGCGACTCTTCTTTTTGTTGACTTTGGACGCTGCCGATGCATTGCCTCGTTGCCACGAAG
CACAACGTCGTATGAGTTTCTTCTTGAACTCTCTTCACATGAAGATTCCGACGATTGATTCGATTGCAGCGATGAAGTCTTTCTCTGTAGTTACGCCGTA
CTACAACGAAACGGTGTTGTTTTCGGTGGATGAGTTGAACGGACGTGTTGACTCGAACCCGCTTTTCCGCAAGGTGGAGCAAAAGGGCCGTGATCTCAGT
ATTTTGAAATACTTGATCACCTTCCACGATGACGAATGGGGTAACTTCCTTGAGCGTGTGGGCGTGGCTTCTATGGACGAGGCGCTTGCAGAGACACCGA
CGCAGGTTCGCCTCTGGGCTTCAATGCGTGGACAGACCTTGGCACGTACAGTGCATGGTATGATGATGTATGAAGATGCACTCAAGATGTTGCGCTGGCT
CGAGATTGGCTCGGACGAGAAAATCTCTCACTTGGAAAAAATCAAGCACATGGATCGCATTGCGGGTCTTAAGTTCTCGTACGTGACCAGTTGCCAGATC
TACGCCGATCAACTTGCAGCTGGAGATTCACGCGCGGCAGATATTGACCTTCTGATGCGCAAGTACCCGAACTGGCGTGTGAGCTACGTGGATACGATCC
GCCCACCCGCAGGCAGCGGCACGGAGCCTCGTTTTGACTGCGTACTGGTCAAGTCGGATGGTGATGAAATTGTTGAGGTGTACCGTTATGAGCTTCCTGG
CAACCCGCTAGTTGGCGAGGGTAAGCCGGAGAACCAGAACATTGCCCTGCCTTTCACACGCGGTGAGTACTTGCAGACGATTGATATGAACCAGGAGCAC
TACTTCGAAGAAGCGCTCAAGATCCCCAATTTCCTGGCGACGGCTACGGAAAACGGAAAGAATGTCACCATTATTGGCATGAAAGAGCACATTTTCACGG
GCCGAGCATCATCTTTGGCACACTTTATGACGTTGCAGGAGTTGGTGTTCGTGAGTTTGACGCAGCGTGTGCTGGCGAATCCCCTGCAGAGTCGTATGCA
CTACGGTCACCCCGATGTGTTCGAGAAGGCATTTGTGATGTCCAATGGCGGTGTATCGAAGGCAAGCAAGGGTATCAATTTGTCCGAAGATGTGTTCGCT
GGATACAATGCAGCCCTTCGCGGCGAACATGTTACTCACCAAGAGTTCATGCAGTGCGGTAAGGGCCGTGATGTGACGCTGAGTCAAATTAACGCTTTCG
AGGCTAAGCTGTCGAACGGTAGTGCTGAAAGCTCCCTAAGTCGCGAGTCGCACCGGATGGGTGCTGGCATGGATTTCTTCCGCTTGAACTCGATGTTCTA
CGGCCACATGGGCTTCTACATCTGTAACGCTTTGGTGGTACTCTGTGTGTTTGCGTACGCGTACGGCAAGGTTTACATCGTGCTTCACCAGGAAATCCAG
GAATCAGCCATCATCACAACGAGCTACCTGGACGACCTGGCAGAGGTGATGAACACGCAGTTTATCTTCCAGTTCGGTATGCTGATGACTATCCCGCTGA
TCGCTACACTTTTCGTGGAGTACGGTTGGCACCAAGCCGTGGTTAACTTCGTGGAGCTGATTGTGACTCTTGGCCCAGTGTTCTACATTTTCGAGACTGG
TACGAAGTCGCACTTCTACGACGTTGCTATTATGCGTGGTGGCTCCAAGTACCGAGGTACCGGTCGTGGCTTCGCCATCGTTCGTGAAACGATGGTGAAC
TTCTACAAGGAATACGCCGCTTCTCACTATCGCAAGGCTGTGGAGCTTATGGGCTTAATGCTTATCTTTGGTACGTACGGTAACTTCAGCATCGGTACGA
ACATACTGGCCGAGTATTGTGCTACTGCGGACTTTGACTGCGACACCAACCCAGACCAGATTCCGTCGAACATCACGCTGCTGAATTCGTACAGCTCTAA
GGGTCAAGATTATGGCATTGCCTCGTTTGCGGTATGGTTGCTCGGCGCATGTTGGCTGCTTGCGCCATTCCTGTTCAACACGGACGGTTTGGACTTCTCC
AAGACCATGGTGGATGTCTCCTACTGGCTCTCGTGGCTCATGTCTGTCAAAGAGGCAGACGGCGATGAAAGGCTTCTTCCGGACCACATGAGCAGCAGTC
CTGCAGGCCCGAAAGACACGTGGAACGATTTCTACAACTATGAGGCCAGCCTCATGTACCCGATTGGTCCGATGAGCCGCTTTGTCTACGCAGTTCGTGA
CTTACGCCACCCGCTGGTCATGTATTATGTGTTCATCTTCTCGTTCAGCCTGAGCGACATCGGGATGCTGTTGGCTTGCGTTGGTGGCATTTCCGTTGTG
CTATGGATCGGCGGTTTTTGGTTTGGGTATGTGCTTGCGCAACTCGGCTCGTGTTCCGCGTGCAGTACTGTACGTGCTGATGGTGATAATTATTGGAGTT
GCTCCATTTGTGGTGGGATCTATGCAAGACTGGGACAGCATCAAGTCCTTCTCGTTGACGGTTGCCATTTTTACGGGGCTCTTTTCTCTCCTGCACTATC
TGCAATTACTACACGGACTGTTCGGTCTGCCTGTTGCTAAGTGGGGTCTCGTTCGCGAACTTGCCTTCTTCTTTGATGTGATCGTTGGTTTGTTCTTGGC
AGTGCCGCTTTTGCTGCTGTCGGCTTTCCCGTTCATGAAGACGATCCAGACGCGTATGATGTACAACGGTGGCTTCTCGCGTGCCTTGAGCTCCGGAAGT
GAATTTGCGGCCTCGCTCAGTGTTGTCGTGGGTGGTCTGGGAGGTTGGACGTATGGCTGGTTG