Description :
From Genome Similarity Track
Location :
contig_124:66733- 72095
Transcript NameFunction/comments
g13517.t1ETI42219.1 hypothetical protein F443_12617 [Phytophthora parasitica P1569

Sequence
5362 bases(100 bases per row)
GCGAGTAACTCGGTAGCTATGAAGAAGGAGAAGCACGGCATGCAGCGGCAGCTGTCGGCGGCGCCTCCCCCGCGTCGACGCGCGCCCTCCAACTACCAGA
CCGTGGAGGACGTGGCAGCCGAGCGCGGCGTGAGCATCAGCCGCCCGCCCATGGACAAGTTCCAGCCGCAGCAGCCCATCGCCGCGTTGACGGCGTCGGG
CCCCATGCGCCCGCCGCGCCCCGGCGCCGACTCGTTCGAGCTGCTGCAGGCCAAATTTGGCTTCCAGGAAGGCAACGTGCGCAACCAAAAGGAGCACTTG
GAGTGCTGGGTGCTCAACTACGAGTCCCGTATCATCGAGGCGGCCGTGACGCCTGTGGACACGGAGAGTGCCATCCAGACCATCCACGCCAAGTTCTTCA
AGAACTACGTCAAGTGGTGCCAGTTCCTGCGCACGCAGCCGCTCCTGCTCGACACGGCGCCGTACCCCGGGGCGGCGGAGCGCCAGATCGCGCTCTTCCT
GCTGATCTGGGGGGAGAGCGGCAATCTGCGCTTCATGCCCGAGTGCCTGTGCTTCCTGTATCACAAGATGGCGGCCAAGCTGGATGGCCTGGAGAAGCTG
CCCAACGCGCCCGACGGCACGTTCTTGCGCCGCGTGGTGCGCCCGCTGTACTCGGTGGTGGCCAAAATGCGCAACGTCACTCCGCAGAAAACGGCGCGGG
CGTCGACCACAAGAACGTGACCAACTACGACGACGTGAACGAGTTCTTCTGGACGGAAACGTGCTTGCACTTTGACGAGGCCAATGTGGCTGGAGCCGTG
AACGCGCAGGACTACAAGTCGTTCAAAGAGCGACGTAGCTTCTGTAACCCCATCCTGGCGTTCTTCCGCATCTACTTCTTCCTGCTCGTCATGCTGCACG
TGCTGGTCGTCATTGCCTACGTGGCTTATCGCTCGGACCCGGACGACACGTCGGGGATCCATTTCTACGCCAACTTTTTCACGTCCGACATCACGGACAT
TCGCAATCACTCCTTCTACTCCATCTTCATGACGGTCAGCGGGTTGCTCGCTGTTAAGGTGGTGCTGGACATTTGGATCGATGGCACACGTGTCTTCAGC
CGCATTATGTACGCGGTGTCGGTGTTCATCCGTCTCGTGTGGCACACTGTGTTCTTCGGCCTCTTCACGGCTGTGAACGCGGCGCCATACAAAGAAGTTG
GCTCGAGCGACTTGCTGTCGATGGCACCCGTTTTCATCGGTGTCTACATGGCGCCGATCGTGATCGTGTCCATTGTGCAGATGTGCTTCCACGGTGTTAT
TTGGAGATCGGCTCTCCTGAGCTCGCTGGATGGGACACGTCAACAGTACATTGGTCGCACGATGGGCCAGAGTTGGGGGAATTTCTTGTCGTACGGAACG
TTTTGGACGATCATTTTCTTGTGCAAGTTCTTGTTCAACTTACAGCTGATGGTTAAGCCGCTTATCGGACCCAGCGTCGAAATCTACGGCGTGGATGTTT
CCGCCGCTCAGCTAGAGAACGGTATCATCGAGTCGCAGCACAACATTGCGTTCCTCGTCGCCATGTGGGCGCCGGTGTTCCTCGTGTACATCTACGACTC
TCAGATTTGGCTAGCTATCGCGCAGGCCATTGTGGGTGCCTGGATTGGTTTCCGTCTCAAGATGGCCACTCGGCACGCATTACAGAGTTCGTGAAGCGCC
TTCAGCAAGCGCCTAGTCTTTTTGACGAGAAGGTGGTGTCTGCTGCAGCCCGCGGTCAACTCGCTATCAACAACAACCCGCTGTCATCGAGTTCTGTTGC
CCCTGATGCCAACAGCCGCCTCCGCTTCGCTGTTGTGTGGAATGAGATTGTGAGCAGTTTCCGTTTGTCTGACTTGTTGGATGATCGTGAAACAGCCATC
CTTCAGTACCAGATCTCAGACACTGGAGCCGTCGAAGAGCCCGTGTTCTTGATTGCTGGCGAGGCACAAGCAGCCGCTGACATTGCCGCCAAGGCTAAAA
CCAAGCGCATGAGTGACGGACAGCTATTCAAGGAGTTGAAGAAGGCAGGCTTACTGGGCTGCGCCAACAACTGTGTTGATATTCTGTTCCAAATTTTACG
TCAGCTACTGGGCCCTGAAGATTCGGAGCTGGTTGGCGTCTTCCATCAAATCCTAGCTGGAGGCAGGGTGAGCGGCGTAGTTAACCTCACGCACATTGGA
TTGGTGCGCGAGAACGTGACTGACTTGCTTGCGAGCATTTTGGACTTGCCGGAGCCAGGTGTCGTTCCTGCTGGTGGCGCCTTTGGCTTCCCGCACGACC
AGGTTCTTATAGTCGTGCAACGCTTGGACGCTCTACTGAAAAGCATTGAGCTTATGCTGGAAGAGGAATGGATGGCAGAAAAACTGCGGAAGTCTGCGTT
TGCCAAGATGACGCCGGACCTTGCTTACCAAAAGGAACAGTTGTTGTCGATCTTTGCTGATCGCATTAGTCAGCGTGACTCGAACTCTCCCACCCGCACG
ACGTCGCCAAGTTCGAATGAGAGTGTGGTGTCGCTTTCCACGCGACTCTTCTTTTTGTTGACTTTGGACGCTGCCGATGCATTGCCTCGTTGCCACGAAG
CACAACGTCGTATGAGTTTCTTCTTGAACTCTCTTCACATGAAGATTCCGACGATTGATTCGATTGCAGCGATGAAGTCTTTCTCTGTAGTTACGCCGTA
CTACAACGAAACGGTGTTGTTTTCGGTGGATGAGTTGAACGGACGTGTTGACTCGAACCCGCTTTTCCGCAAGGTGGAGCAAAAGGGCCGTGATCTCAGT
ATTTTGAAATACTTGATCACCTTCCACGATGACGAATGGGGTAACTTCCTTGAGCGTGTGGGCGTGGCTTCTATGGACGAGGCGCTTGCAGAGACACCGA
CGCAGGTTCGCCTCTGGGCTTCAATGCGTGGACAGACCTTGGCACGTACAGTGCATGGTATGATGATGTATGAAGATGCACTCAAGATGTTGCGCTGGCT
CGAGATTGGCTCGGACGAGAAAATCTCTCACTTGGAAAAAATCAAGCACATGGATCGCATTGCGGGTCTTAAGTTCTCGTACGTGACCAGTTGCCAGATC
TACGCCGATCAACTTGCAGCTGGAGATTCACGCGCGGCAGATATTGACCTTCTGATGCGCAAGTACCCGAACTGGCGTGTGAGCTACGTGGATACGATCC
GCCCACCCGCAGGCAGCGGCACGGAGCCTCGTTTTGACTGCGTACTGGTCAAGTCGGATGGTGATGAAATTGTTGAGGTGTACCGTTATGAGCTTCCTGG
CAACCGCTAGTTGGCGAGGGTAAGCCGGAGAACCAGAACATTGCCCTGCCTTTCACACGCGGTGAGTACTTGCAGACGATTGATATGAACCAGGAGCACT
ACTTCGAAGAAGCGCTCAAGATCCCCAATTTCCTGGCGACGGCTACGGAAAACGGAAAGAATGTCACCATTATTGGCATGAAAGAGCACATTTTCACGGG
CCGAGCATCATCTTTGGCACACTTTATGACGTTGCAGGAGTTGGTGTTCGTGAGTTTGACGCAGCGTGTGCTGGCGAATCCCCTGCAGAGTCGTATGCAC
TACGGTCACCCCGATGTGTTCGAGAAGGCATTTGTGATGTCCAATGGCGGTGTATCGAAGGCAAGCAAGGGTATCAATTTGTCCGAAGATGTGTTCGCTG
GATACAATGCAGCCCTTCGCGGCGAACATGTTACTCACCAAGAGTTCATGCAGTGCGGTAAGGGCCGTGATGTGACGCTGAGTCAAATTAACGCTTTCGA
GGCTAAGCTGTCGAACGGTAGTGCTGAAAGCTCCCTAAGTCGCGAGTCGCACCGGATGGGTGCTGGCATGGATTTCTTCCGCTTGAACTCGATGTTCTAC
GGCCACATGGGCTTCTACATCTGTAACGCTTTGGTGGTACTCTGTGTGTTTGCGTACGCGTACGGCAAGGTTTACATCGTGCTTCACCAGGAAATCCAGG
AATCAGCCATCATCACAACGAGCTACCTGGACGACCTGGCAGAGGTGATGAACACGCAGTTTATCTTCCAGTTCGGTATGCTGATGACTATCCCGCTGAT
CGCTACACTTTTCGTGGAGTACGGTTGGCACCAAGCCGTGGTTAACTTCGTGGAGCTGATTGTGACTCTTGGCCCAGTGTTCTACATTTTCGAGACTGGT
ACGAAGTCGCACTTCTACGACGTTGCTATTATGCGTGGTGGCTCCAAGTACCGAGGTACCGGTCGTGGCTTCGCCATCGTTCGTGAAACGATGGTGAACT
TCTACAAGGAATACGCCGCTTCTCACTATCGCAAGGCTGTGGAGCTTATGGGCTTAATGCTTATCTTTGGTACGTACGGTAACTTCAGCATCGGTACGAA
CATACTGGCCGAGTATTGTGCTACTGCGGACTTTGACTGCGACACCAACCCAGACCAGATTCCGTCGAACATCACGCTGCTGAATTCGTACAGCTCTAAG
GGTCAAGATTATGGCATTGCCTCGTTTGCGGTATGGTTGCTCGGCGCATGTTGGCTGCTTGCGCCATTCCTGTTCAACACGGACGGTTTGGACTTCTCCA
AGACCATGGTGGATGTCTCCTACTGGCTCTCGTGGCTCATGTCTGTCAAAGAGGCAGACGGCGATGAAAGGCTTCTTCCGGACCACATGAGCAGCAGTCC
TGCAGGCCCGAAAGACACGTGGAACGATTTCTACAACTATGAGGCCAGCCTCATGTACCCGATTGGTCCGATGAGCCGCTTTGTCTACGCAGTTCGTGAC
TTACGCCACCCGCTGGTCATGTATTATGTGTTCATCTTCTCGTTCAGCCTGAGCGACATCGGGATGCTGTTGGCTTGCGTTGGTGGCATTTCCGTTGTGC
TATGGATCGGCGGTTTTTGGTTTGGGTATGTGCTTGCGCAACTCGGCTCGTGTTCCGCGTGCAGTACTGTACGTGCTGATGGTGATAATTATTGGAGTTG
CTCCATTTGTGGTGGGATCTATGCAAGACTGGGACAGCATCAAGTCCTTCTCGTTGACGGTTGCCATTTTTACGGGGCTCTTTTCTCTCCTGCACTATCT
GCAATTACTACACGGACTGTTCGGTCTGCCTGTTGCTAAGTGGGGTCTCGTTCGCGAACTTGCCTTCTTCTTTGATGTGATCGTTGGTTTGTTCTTGGCA
GTGCCGCTTTTGCTGCTGTCGGCTTTCCCGTTCATGAAGACGATCCAGACGCGTATGATGTACAACGGTGGCTTCTCGCGTGCCTTGAGCTCCGGAAGTG
AATTTGCGGCCTCGCTCAGTGTTGTCGTGGGTGGTCTGGGAGGTTGGACGTATGGCTGGTTG