Description :
From Genome Similarity Track
Location :
Scaffold_33:66731- 68625
Transcript NameFunction/comments
Albla_Nc14034640myosinlike protein putative

Sequence
1894 bases(100 bases per row)
GGTGTTGAGGATATGGTTCAACTGAGGCATTTACATGAGGCGTCCATATTGCAAAATATTCGTCAACGCTTTCACTGTCAAGTCCCTTATACATACACTG
GTGAAATATGTATCGCTATGAACCCGTACCAAAGAATAGAATCTTTGTACGATGAAAGAACTATTCAAAAGTACAACAATTTACACAATGACTCCATTCA
TTCTCTACCGCCTCACGTTTATGCAATCTCCGTGTCTGCTCATCAAGCAATGCGTCTGCATCGAAAGAATCAGAGCATTCTTGTGAGTGGGGAGTCAGGC
GCTGGGAAAACAGAAACTACGAAAATTATCATGGAGAATTTGGCAACAATTGGAGCAATGGAAGGAGACTCTCATAAACACAAAACGGTACAGCTTATAT
TGCAAATGAACCCGCTTTTGGAGTCTTTTGGTAATGCACAAACAGTCCGGAATGATAATAGTAGTCGATTTGGCAAATTTACAAGGTTGCAGTTTGACCC
CGATGGTAATTTTCTGATTGTTGGAGCCAAATGTCAGACGTACTTGCTTGAGAAATCAAGAGTGGTAAAGCAGGAGCAAGGAGAACGCAACTTTCATATT
TTTTATCACTTACTGTATGGCCTAACGTCATCAAAAGATTCAGAGCATTTCTTCTTTTCATCCAAGGGCTCCAGGATCAATTTTGCATACCTTCGACCTG
ATGAGGCAGAGAAAATCAACCATGAAGAAATGATAAGACAACTAGAGCATACTAAAAGCTCCTTCGATTTACTTGGCTTGGATCCTTCTTCGCAGCGTAG
TATACTAGAAACAATAGCTGGTATTCTTCATTTAGGCGAGGTCGTCTTCATAAAACAAGAGACAAATCAACAAGAATCGTGTGCAGTGGATACAAAAAGC
GCGAATCCTAGCTGCAAACTCTTGGGGTTTAAATTGGATGATATGGTGAATGCGTTATGCTTTCGCACAATGCACGCAGCAAACGAAGAATATCGTGTTC
CACTATCATTGGATCAAGCTGTTACGGGGAGGGATGCATTAGCCAAGACCCTTTACGCGAATATCTTCGACTGGATAGTGAAGAAAGTGAATGCTGTACT
CACAAACGAAATGAATGGATTATTTACGATCGGGGTATTGGATATATTCGGCTTTGAAAGCTTTCAAGTCAATTTCTTCGAGCAGCTGTGTATTAACTAC
GCAAATGAAAAGCTCCAGCAAAAATTCACACACGATGTTTTTCAAAGTGTCCAAGTAGAGTATGAGCAAGAGGGAATCGAGTGGGGACACATTCCATACG
TCGATAATTGCCGAGTTCTTCAGGCTATCGAAGGCAGACTCGGAATAATAGCTTTGCTAAATGAAGAAGTGACTCGTCCACAGGGAAACGAGACATCCTT
TGTCAGGAAGCTTGAACAGCATTCCAATGCAAAGCATGGCGAGAAATTAAATCATGCAATCATCACAATTCCTCGACACTCGGTCACAGAATTTGTTATT
CATCACTACGCTGGAAGCGTGCAATATGAAGCAAAGGGTTTCATGAAGAAGCATTTAGATACATTACACGGCGATCTTCGTGAACTTGTACGAATAAAGT
GCTCGAAACAGTTCATTGTCGACACTTTTCAAGAACCGCCAGCGACCTCGAAATCGACTTTAAGAAGAAAAAGCTCACATTCAACAACTGTCGGAACCCA
ATTTAAAAACTCATTAAATAATCTCATGAAATGTATCGAGGAAACAAACGTGAGGTACATCCGCTGTATCAAGCCAAACAAGAAGAAAAGCCGGGATGAG
TTTGATGCTGTAATGGTGGCTGACCAACTACGCTGCGCCGGCGTCATCGATGCTGTTCGAATAGCACGAAGCGGATACCCAATTCGAATGGCCC