Description :
From Genome Similarity Track
Location :
Scaffold_186:66724- 68230
Sequence
1506 bases(100 bases per row)
GACCTGATCACCGGACCCAACATTACCGCGTTGATGGCCGATCGCCCCTGGCAGGTGCTGCAGAACCCGGCCAACCCGTTGACTTTCGATCTGGCACTCC
ATCGAGGCGCCGGCACTCGATCGGGTCGGATCGCCACCGCCTACCTTCAACTCGAGGCGCAGCATCGCCAGGCCTTCTGGGAAACCACTCTTTATCTCCC
GATCACGGCCGCGCAGCGTCGGGACCCGATCGTTGAGCAATATCATCGCGATCGCAGAGCCCAACGGATCCGTCTCGGTGATTGGTGGCGCCGACTCCTC
GACGCGATGTTGCCCATGATGCGAGAGATGTGGGCAGACGTCGATCTGCTGCTGGACCCGTTCTTCTTGCAGATCCCGGTGCGACAGCGGGACGCTGTGA
CCTGGTAACTCGGTGTGGTGTCTCGCGCTGCGATTGCTGGCGACCCCACCCAGCACCACGGTGAACCGACCGACCTCCGAACGGCTCTGATCGAGGCCGA
CACCCATGACCCCTGGCGGAACCAGTATCGCGACCACCCCCAGGACCATCACGCTCAACGGATCCCGCGCCTCCGCAACAAGTTCAACCCCAACGTCGGC
GCCCAGTACCAGCGATGACATGATCGCCGTCTCTGCGATCGACTTCCGTAAGTAGCGAGCCAGTCGACCATTACACCCTCAGAGTCGGAGTGACCCGGAG
GCCGATCTTCCATACGCGTAACGCGACATATTCAGATTAATCCATTCCATCGTAACAATCAGCATTCTTCCTCGATGTCCCACTGTCCCTGTCAATCCAT
TCGTTGCTAGCTCGATCGGCCAGGATCCGTCCTCATGCACTCGCTCCATAACCATCCTATCTGCACTCACGTACCCACACTCATTCATATACAACCCCTT
CCTCCGATCTACGGCCTCCCCGTCGATCCGTCATCCATCTCGCTCACCAAGGCGACCATGTCCGTGATCTTCTCCACTTCGTACTCGTTCGAGTCTCGAT
CTGAGGCCCAGCTGTCCTCCGGAATAACGCCACCGTCGAGGATTCCGATCCCGAGTCCGAGTACTACCCAAAGGTATCGTCGCCTCAAGCGTCGATCGAG
GATCCCAACCATGCACCAACTTCAGCTTCGAGACATGCACGATCGGGAACAGGTGATAGTCTGTACCAGCGATCTGAAGTTTCATCGTGTACTCGTTCAC
CTTCTCCGCAACGCGGAACGGGCCGTGCCACAGGTGAGCCAGCTTCCGGGCATACCCCTCTCTCACACGATCCAGGTACAGTCACACCTGAGATCCAGCC
TCGATCGAGTGTGGTCGAACTTCTTCATTGTGTCGATCGGCCCGATCCGCGATCGCCTCGCGTAGGCGAACATTCACCTGACTTCGTGCCTGATCGTAGT
GCCTCTGGATCCGATAACGCCACCGTCGAGGATTCCGATCCCGAGTCCGAGTACTACCCAAAGGTATCGTCGCCTCAAGCGTCGATCGAGGATCCCAACC
ATGCAC