Description :
From Genome Similarity Track
Location :
scaffold_128:66720- 67743
Transcript NameFunction/comments
g4217.t1 glutathione S-transferase, putative

Sequence
1023 bases(100 bases per row)
TCAAGCTCACGTACTTCGCCGGTCCCGGGCGAGCCGAGCTTTCGCGTCTGATCCTGTCTGCCGGCAACGTGTCCTTCGAGGACGAGCGCCTGGACCGCGA
CGCCTTCCTGGCCATCAAGCCCGCGCTGCCGCTCGGACAAGTGCCAGTGCTGGAGGTAGATGGCACGACATACAGCCAGAGTATGGCCATCGCACGCTAC
GCTGCCAAGCTGACGGGCCTGTACCCGCAAAACCCGCTCGAATGCCTGCGTGTTGACATGGTGTCGGAGTCGCTCGTCGACATCAAAGCGCTCATCACGG
AAGTCACTTACCGCACACCGGACGAGGCTGTTAAGGCCGAGAAGACGAAGAAGCTGTTGGAGGAAAGCGTGCCTAAGACGTTTAAGCTGCTTGAAGGGTT
CGTCCAGGAGGGTCCCTTCTTCCTAGGCGACAAGATGACGTACGCGGATCTACAGCTCTTTGACATGACCAAGAACGCACTAGCCAGCTTTGCGGGCTTC
TCGCTGGACAAGTACCCGAAGCTGACGGGGCTGGTTGCCAAGGTGGAATCGAACCCCAACGTGGCGGCCTACCTGAACAAGTAGAAGAAAGAGGAGGAGG
ATTGGTGAAAAAGTAAATGAATTTCACATCCAGTGAGTGAGATCATGCGTGTTGGTCACCCATACGGCCGTGTTTATGGTATTCGAGAATCTTGTGCTCA
TCGTGATTCATCATCTAGTCACCGTTGGTTGCAGCTCGAGCTCATTCGAGAATTCACTCCACTCCACACAAGTTCCTCACAATGACCCAGCCCCAGCTCA
AGCTCACCTACTTCGACGGCAAGGGCCGCGCAGAGCTCTCGCGCCTGATCTTCAACTACGGCGGCATCTCCTTCACGGACGACCGGATCGCGCACGCCGA
CTTCGCGGTGATCAAGCCGACGCTGCCGTTCGGCCAGGTGCCGGTCCTTGAGCTGGACGGCACGGTGTACGCCCAGAGCATGGCCATCTCCCGCTACGCC
GCCAAGCTCGCCGGTCTGTACCC