Description :
From Genome Similarity Track
Location :
Scaffold_1026:6672- 8174
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1026-snap-gene-0.0Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_1026-snap-gene-0.1Reverse transcriptase
Pytap_DAOMBR444maker-pag1_scaffold_1026-snap-gene-0.2Reverse transcriptase

Sequence
1502 bases(100 bases per row)
TTGGAGAGGGTAATGCCCTTCCTCCGCCCATTCGGGGAGTTGTGTGCGgCATTGATGTCgtAGATTCGAGACCtGTCTGTGATCGAGCTCGGGGAATCCC
ACAACACcAGTTACCTCAAGTGTACGAGTTACTGAAGAAGTTGTTGGAAtcGGGCATTAACAGGTTTTCcAACTcGGAATGGGCATCCCCAATTGTGATC
GTGATGAAGAAGAATGGTAAAGACATCCGACTTTGTATCGATTACCGCAAGGTGAACCTCTTGATTAAGTTGATGAACTATCCACTCCCTGTCATCGATG
AGTTGTTGGAAAACCTCGATGAAGTTTGGTGGTTGTGCAGTCTGGACATGGCTAGTGGATTCTGGCGGAATGACTGCTCGAGCTTCAGCAATCTCAGCTT
TCGtCTGTCCACTAGGCCATTTCGAGTGGGTTCGGATGCCGTTCGGGTTAAAGAATGCACCACTGATCTACCAGATGGTGATCAGCAACTCTCTCTGGGG
ATGGGTCCGTTTACCTTCCGCACTCGAAGCCGAAGTTGACGATGAAGTGCTTGAGTACTTCGGTATTGCGAAGGTTCATGATGCTCCTGAGGTCGTGAGA
GTCACGGACGGTGGACCTACGGTTTTTGATTTGGGGATTCCTACACCCTCGAATATGGgTCCAGTCCTtGGCCGAAGCTCTTACATCGATGACATCGGGT
TTGGTTtgAAGGATCTCGGAGAAATGGCCAAGATGTTGGATGCCCTCCTCTATCGTTTGAGGTATTGGGGTGTTTCGGTCAGTTTGCCTAAGAGTACTTT
CGGAATGCACTCAATTCCGTACTTGTCGCACGACATCTCGCCTGAGGGGGTCAAGCCGATTTCCAAACTCGCCAAAGGTCTCAAAGAACTTCCGTTCCCC
AAGAATCTGAAAGGGGTTCAGTCATTTCTCGGGTCTCTGAACTATTATCACAAGTTCATCGAGGACTACTCGGTTGTGGCAGCTCCTCTTTacGAGTTAT
CGGATGACCAGGTGCGAGCCGGGACAGaTcTCGAGTCTGCACATGCAGCATTtCGAGGTTCTGAAAACCAaGATGTTGAATGCTCCAGTTCTCCGACNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATGCAGAaCTCCGGtAgcAcATCACTGAGAAaGAAGTTCTGGCACTttCTGAGGACTCTGACCA
CGTTCTACAcaTTGGTCGTCGGGCGATcTCtCAAGGTTTTTACAAGGTATTGGgTACTGAAGTGGCTTctCACCTCGAGAACCCTCCAAGGTCGGTGTCT
GCAATGagCTACCCTTCTCTCACCGTGGtCTATGGAAcTCcACCGTATTGAACAaGACGAAGATGGCCTAGCGgCAtCGCTCGCAGCAGGAATTAaTCCC
cG