Description :
From Genome Similarity Track
Location :
Scaffold_116:66712- 67866
Transcript NameFunction/comments
Phyta_totarag3938multicopper oxidase, putative

Sequence
1154 bases(100 bases per row)
GGGGCGATGTGGCACTGGGTGACCTCGGACGTGCCGTCCATCTCTTGGGTGCCGAGTTGCTTCAAACCGTGCCAGTGCAAGCACGTGGGTTCTTCAAGCT
CGTTAGTGACACGCACTTCGACCTCTTGACCGAGCTCCACGTCGATGACGGCTTGGTCCGCATGTTTGTCGTTGATACCGAGCGAGTGAATGAACACGCC
GTCGTATTCGCTGGTGAGGGACGTAACACGCCAGTCGTAGGTGACGAGGTCAGCTGCACTTGGTCCAAGgtggagcgcgagaagacCCGCCATGGCGGCG
GGAAAGCTACCGAGTTTCATGGTGAAGACGGTTTGTGTGGGACTCTAGTGTGGGTGGGGTCGAGTATCCGTTGTTGGCGGTCGAGTGCAAACTGCAGAAT
GTAGATTGAGTGATGAAGACCTCTTTAGCTCTGTTAACTCGAAGGACTTGGCTCGGCTCATGTGACCAATGACCAATGGTGAGCACATGCTCGGAGCGTG
ACGCGTTGTGTGGCTTTGCAAGCGTGAGGCACCACCGGGAATTTTAGAAAGCCGGAAATTGGGATATCTGGCACCAGCAATGTCGCTTGAATCCCGTGTG
CTCCGTACAGTTTTGACTCTTTATGATCTGCTGTGAGAGAGACTGTAAACATCGTGACCATCAGAACCCCGTCGTGCAATCACTCGGCAAAGGTTACCAG
GCCGGCAACACTCGACGCCCAATGTTCTAGTCGAATTGAATGACGTGCTTAGAGCCATAACCGGAAATGCAGCATTTAAAATGTCCAGATGAACGGCTCG
ACATGCATCGGTTGTTTATGTGTTGCGACTCGCACCGTACGAGCTGTAAACGACAGCTCCAAAGATACACTAATATCGGCCACCATGATTGTGGGCAACG
TGCACAGTACTGGTCCATGTACACTAATCTGCCCCAATAAAGAATACGACAAAACGTCTAACCTTCTAAACTGTATGCACATGGTCGAGGACCGCACCAA
GTGTGTACTGTACGCCTACCTCTGATGTCTTATTatcttggagtttgtatATAAGTCGTGATTTCTGTATTGAGTCAGATTACTGCAAATGTACCGGTGA
TGGTCCATCATCATTACGAACAAGTAAAATAATCATTGATTGCATCGTAAAAAA