Description :
From Genome Similarity Track
Location :
contig_19:667048- 669320
Transcript NameFunction/comments
g4455.t1hypothetical protein L917_03399

Sequence
2272 bases(100 bases per row)
GAACTTACGCGTGCGCAGCTCCTCGAGCGCTTCGAGGGCGCCTTGGCGGAAGAACACACGCGTCTTACCGACCTGGTACTCGCTCTCCTTGCCAGGCATC
AAGTGGTTCTCGAGCAGCTCACGAACAGCAGCGGCCGTCTTCGTATCGTCCGTCGGGTTCTCGTCCGCAGTAGCGGTAAGCACAGCAAGGGCGGACGGAT
TGCCGTCCACAGTCGTAGTCGACGCCACGCCACGGAAACGCTCCAGGAACATCGTCTGCAGTACACGGTTGGGGTACGCCATGCGACTGATGCGCACAGC
CTCCACCACGCCAGCGCATTGCAGCTGCTCCGTCACGCGCAGTTTGTTGAAGATCAGTGGGCTCTTCTTGCCGTTAGGCTTGATGCAACGAATGTAGTGC
ACGTTCGTGCGACGGATTCCTCCATGAGACCGTTCAGCTGGCTCTTGAACTGCGTGCCCACCGTGTCGGCAACAATAGAGTTCTTGCGCTTAAGGGCGGG
CCGCCCACGTGAAGCATTAGATGCAGAAGCTGCACTCGTACCGGGGATACCCGTCATCGCATCACCAACGTGCTCGTCCGGGAACAGCTTCTTTAGGAAC
GGCGCCTTCGACTTCTTGATCAGCAAGATCAGGTCGTTCTGAAGCGCATCCGTGTTCTTGATCAGGAAGCCATTCGTATCGTACTGCACAGGTCCGGCGT
AGTGCTTAATAACGAATGCATCGCGGGCAAAGCGCGGGCACTCGAAGCGGTCGTTGTCGCTGTAATGAGCCTTCAGCTTGTTGGCGAAGGCGGCATCGCT
ACCCTTGGGGCGCATGCACTCCTCATTCAGCAGCGACAACACACCAAAGCGCCCTTCAAGCAGCGACAGCACGTTCACATTATCCGCGAACTCGATGCGC
GTCCAGGGAATGCCCTCGTCCTCATACTCCTGCTGGATGGACTTGAAGACGTCCTGCGTAAACTTCTGCTGCAGCTTCTCGTTGGCGTAGTTGATGCACA
GCTGCTCGAACGAGTTCTTCTCGAAGATTTCAAAGCCAAAAATATCCAGGATGCAAATCTTGTGAGCCACATCCGCGTGTGACGCGCTCGTCGACATGTT
GACTCGGTGGATCAGCCACGAGAACATGTGCGAGTACAGGGCCACGCCCAAAGCAGTTCGCGCACCTTCGGCCTGCGAGACGTTCAGAGGCACCTCGTAC
GTCTCCATGACCGCCGTCATCTCGCGCGTGCAAAGCGCCGTGTGCAGCTGGTTGTCATCAAACTCAAGGAGCTGCGACACGAGTTCGCTTGCGTGCTGGT
TCTCGGGGTGCTCGTCAGCTGCGACGCGTCATCGTTACCAGGGGTGGGCTCGAACTGGATGCGGGACAGGTGCAGAATGGCCGCCACAATCTTGAAGATG
CTCATCTGGTCCTCCTTGGACACACTCATCGTGTCCAGACACGACACCGTCTGCTGGAATCTCTCGGCGTCCTTCAATCCCGCGCTGACGTCAGTTCCAT
TGGCGAGGTCCTCGTCGTGCGGCTTGATGAACGGGAAGTTTTTGGCCTCCATGCCCGTGACCTTCACCTCCGTCGTCACGTGCTCGGGGGCCGCCAGCAG
CTGGTAGAAAATATGGTAATTGCGCTCGCCCAGACCTTGCAGTGACACGCGCGACTTCTCCAGCAAGTACGTGCGCGAGCGGGCGCCAATCAAATCACCC
AAAGCGTCGAACTGCAACTCGGAGAATTTACCGAAGCGACTGGAATTGTCGTTGCGCGACGTTTTCGCGTTACCGAACGACTCCATCAGCGGGTTGGCGT
CCAGCACCCGCTCGATGATGCTGGCCTCCTTGGCCTGGGCGTCAGATGTTGAGTGGCTGCCGGCCGATGCCAAGTGAGACATTAAAATCTTGGTCGTCTC
CGTCTTACCGGCGCCGGACTCGCCACTGACCAGGATACTTTGGTCCTCTCCGAACACGCGCATGTGCTGGAAGGCCCCGGCACTGGTCGCGTACACGTGG
GGCGGCAACTCGCTGCGGTCGCGCTCCAGGTACTGCTCTTGCAGCTCCTTGGTGTAGATATCGAGCCACGAGTACTGAAATAGCGACATATTCGCGTTAG
ATAATATCCGGATATTCCGCATTGAAAAGGGAACAAAATAGGATGTTCTGACGTACCGGGTTGACTGCAATGCAAATGGCGCCCGTGTATGTATAGGGAT
TTGACGCAAGAAGCGGTGCTTAAGGTTGAACAGGATGGCCGGCTCGTGGAGGTAGTTCAGGGTCACCATGTC