Description :
From Genome Similarity Track
Location :
Scaffold_473:6670- 10801
Transcript NameFunction/comments
Phymu_g10206hypothetical protein PHYSODRAFT_333373

Sequence
4131 bases(100 bases per row)
gacgaggtggaagaggGCGGATCTCCGTGCTGAAAGTCTCACCGAGGGTTAAAACTCCACTAACAGCTCCACCAAGTGCTGTCTCCACGTCAAGAAGCGA
GTTTGCAAGCGATTCCGAGGTCCGCGATGCGTCTACAACGAGTTCCCATGGCGATTCTGGTCACCCAAACGCAGATTTAGTCGACAAACTCAAAGGATTC
AGTCGAGCGGCGCAATCCATCATCAATatgcacaagctgcagaatcCACTTAAACCTGCAGAGACCTCGACTCCAAAGCCCTCGAAAGACCCGTGGGCTG
CCGTTATGAGCAGTGTCGTGCGCAAAGCACCGAAACATCATGCGGGTGATCTGGGGCTGAATCTTGGCGGCAATGGCCCTACGTCGGAAAAGAGGATTTC
GTTGGCTCAAATGCTGAAAAGTCGAGAAATGAAGAATTTAGTGCAACAAGCTCTCGTCACGAAGCAACTCACAAGAACAGTAGCAGTACCGGAGGAGCAG
TCCAGTGTGATGTCTCATTGGATAAAGTTGTCCTCTTTGAGAAGAAAGCAGAACGAATTGGAGGACGACGGAACGACGGGGGACCCTTTTCGAgttgaca
gcagcagaaacaacgACGCCTCGGACGCAGACTCCGACATTGTGGAGGACCCGGATGGGGTCCATTCGGCTTTTGACTTGGACGATACCGCTAAAGGCCA
TCAGCTCTACGGCCGTACGCTCATCCTGGAAGAATCTTGTCGTAGAGCTTTAGCCCAAGACTGCGACCAGCGCTCTCAGATGGATCTGCAGTCTCTTGGG
GTCTGGTTCCAGACCACAAAACTGAAAATCACGACCGATTTCGAGCGGCTACAGCCTTCCGAGCTCGATCTGCTCTGTCGACGCATGACTCGTGTCACTT
TCCACCCAGACGAGACCGTTTTCCGCCAAGgggacgaaggagacgcGCTGTACATTGTTTTTAGTGGAACAGTGGAGGTTCGCGTCAGCCAGCGTATCCT
TGGGGAGGTCGTGGAGGTCATTGTATGTGAATTAGGTAAAGGAGACTACTTCGGCGAGCGCTCTCTGCTGAATAACGACGTACGAGCGGCCACGGTACTG
GCGAAATCTGCCTCGGAACTGGTGAAAATCACTCGGAATGACTACAATCTCATGCTGAAGAACGACCAGCTCGAGTTCCTCTCTCGAATGCAAATTGCGA
ACGGAATCGGCGTCCAGCGCCCGGTGCAACGCACCCAGCGTGAATATATTAAAGTTTTAACGAAAAAGAAGCACGCCCGAAGCAAAGCCGACATCGACAT
GCTAAGTGAATACTTGCAAACCCTGAAATTCTTCCGCAGTTTACCGAAATCCTTTGTGCGAGAGCTctgcgtggtggtggattTCCTCACACTCCCGGCA
GGGGCTTGTGTCTTTCGAGAGGGGGAAGTTGGCGACCTGTTTTACATTATCTTCAGTGGCTCAGCGGACGTGAACATCAACTCGAAAGACTTCAAAGGCA
ACTTACAGATGACGAAGCTCGTTAACCTAACAGAGGGGGCTCACTTTGGCGAATTGGCGTTGATGAAAGGCCGAGGAGTACGCAGTGCGACTGTTATCAC
TCGAGAGGAGTGCCAACTTCTGGTCATTTGTGAAAAAGACTACAACTCCACCCTCCGAcggatgcagaagaaggataTGGCCAAGCGAGTGGGAGTTTTA
GACCAGATTCCGATGTTCCAGACCCCGGAGTGGACTGGAGAACTGCTGAAAGAGCTGTCGTACGTCCTGTTAGAGCAGAAACTCGCAACTGGAAGCGTAC
TGTACAACCAAGGGGATCGCGCTACTCACGTGTACTTTGTCGTTCGAGGAGAACTCGTCGTTACGAAGGAGATCGCAGACCCCTTCACTCAGGTGAAGCA
CGAGGTTTTCGTCGAGCGCATCGGTCGATATCGAGTGGTTGGAGACGATGCGTAcgtagtttttttttcttcttcttctcttttgtTTAACCCTTTGTCG
ATCCTAAGTGTCAATTGTttgtagagctgctggggTGAATTTCAACGAGGTGATCCATCGTGAAGTGACTGTGAGCGCGAGTACTCCAGTTGAAGTGTTA
CAACTCTCAAAGTACGACGTCTTCCACCGTCTGTCCAGGTCTGCTCGAGAAACCTTGCGAGCTGCCGCCCAGTCCCACGCCGAGAGCATCGTGTACTTGG
ATCGGTTCCACAAGACGCAGAAGTGGGAAGCCTACAAGAAAAAAGTGCTGCGAGACCACGTTAACCACGAACGAATCGAGAAAATCttgccttctgctgc
tgcaaaacCAGCAAAACTGAGAAACCCTGCAAAAACCTCTCAATCTCGCCCGGCCGCAGTGCCTCCTTCGGTTCAAGGCGGCCTGCTGCCACCACTTCCG
CTTCCTACTGTCAATAACGACAAGAAAGCTGTTGCTTCTCGTTCAAatggctccagcagcgagaaacAAGCGCTCGTCCCTGCCAACgaactgttgctgc
tggcgcaggAGGCGAAAGCCATAGAGAAGTGCTTTGATCCGCACCAAACGCTTGGGAAGTACGTCACGTCTTTCAACGTCGATGCGCCGCCCAGTTCGGC
TCGACAAGGTGAATTGGACGGGGTATTGGAAGCGGAAAAACGACGGCAAGCGGAAGTCCTAAAGGAGGGAAACCCActggccttcttcgacatcaaAGTC
GTCGATAAGCAGCCTGGTGCGTCGTGGAGGGCGAAGGCTCTTGACGGAGAGCAGCGAGAGAGTACCGAGGAAGAAACTCCAGTGCCAATTACCCCTCCGA
CACGGAATGGAACCACAAGTCTGACCGTCACGTCTCAAGCTTTAAGTCAACTTTTACAAGAAAATTTTATCTTTTCTCGCCCGCATGAAGCCAAGCCACA
AGGTCACGATGCTCGGAAAGGGAGGACATTTCAGCCCCGACTCTCGATCAAGAATGCAGTACGGAAGGTATCGTCTTCACGTCCAAGAGGACATTCACCG
TCTCGAATGGAGGGTACCGCTGAAACAGACTACGTTCTCGTCGCCATTAGAAGCgaaatggacgaggagagGCCAGAAACCACGAAATCTCCttcgctcc
agcttctccagtctgTTCGAAGTCTCCTTGCAGCTCGCGAAGCCGTCGAGAGGCTGAAAGAAAGTGATTTTGGCCCTGTAAAGTTCTACGTCTTACCACT
GAAGGCCTTCGCTCTCCTGCCACGTTCCGAGCGGTCAAaactggacgaagagcgTCTCCAATGGCAGCAGACGAGCGAGATGACTTCCAGTAGTCGAGCG
AAAGCTCTAACTAGTCCGTCCGTTGACGACTCTACCAGCTCCTTGCACTCAACAGGAGACAACTCGATCCTCTTCGCGTCCTTCCAAGAAGTGGCCGTCT
CCTCTGTTTCAGACGAAGGGCACGTGCATCTTCCCGGGAGTATTGATGCTGCGTCAAGCCCTACAAATACTATCACCACCCAGTCGAGCTTCACGTCACC
TCGAAGGAAACCTGGAAATCCCGTTGCGAGCAATGTCCGGAATGCGTTCGCAGTTGCCAGTGTCGTTCTCTCGAAGCTGGAAGTAGCGCACTCGCAGTAC
CCAGAACCTTTTGTGGCTATCCACGGCCTCTATATATCCGAGATGGAGGCTGTGACGTACGCTATGAACTTGAAGCCGTCCCAGTCGCTGAAGAGCGCCA
TGTTGTGCGTGTTTCCTGTTGgcaaatggctacatctcGAACACGCCCATGACTGGTGCGTGCAGGTGGAAGTGAACAAACGAGAGAAGCGAGCGTCTTT
GATTGGGCCCGCGCCGACGTCACCAACTGCATCAAGTCTGACAGGGAGATCGCGACGGCTGTCACTAGTTCCAGATCCACCGAAGCCGAAGTGGCAACAG
GAACAAGAGGAGGCAAAACGACTGCACAATTTTATTTGTGCGCGTATGGGAGCCccagcaatggagaagaagaaggatcGAGTCGAGGAGAGTGGCGGAT
TTACGCCTAAACCTCTGGTCTCACTCGAGGACAAACTGGAAACACTTCACAACTATCTGCAGGCGACTGCGGCGTTTACTGAACGAACTGGACACGGAGG
TGTAGCCATGTTGAAATACCGACAAGTGAAG