Description :
From Genome Similarity Track
Location :
Scaffold_46:6670- 9361
Transcript NameFunction/comments
Phyag_g1134hypothetical protein PHYSODRAFT_553621
Phyag_g1135hypothetical protein PHYSODRAFT_553621

Sequence
2691 bases(100 bases per row)
CCGAACCTAATGCGCGCGTCACAGACTACGccgacatgctgctggatgaagcgtCAAAGCACCTTGCGCGCTTCGTGCGTGGCGAGACGGAGACTTCGAC
TGAGAAACCGAAGCTTCGACCACTGGAGAACAAACCACAGACCTTTGAGAAGAACAAAaaggtcaagaagaacgagaaggaggaggttgttgagaagaag
acggcgcgAGGAGCTCAGGACAAGCCACAGGACCGATTTgacgagaagatcgacaaCTCCGAGGCTCCATTTGTATCCAAATTGCGTGAGAAGGTGCACG
CGCTAaatgatggagctgcaactACAGCGATGGAAGATGAGGATGACGAGATGGCACCGCGTCATCCGTACTTCCCAGAGATTAAGGGACTGAAGTATGC
ACAGTGGCAATTAGAAGCGTCTGCTGAGCCATATGAGATGGTGGAGCTTGAGAAGGCGTCGTATCTGTGGGTGGACTCGGAAgagaagttggtgcagatg
atgaagtcgctgactgctgcagaagctaGTGTGATTGCGGTGGATTTGGAACACCATAGCTACAGATCGTACATGGGACTCACGTGTCTAATGCAGATTT
CGACAGCGACTGAGGACTTTTTGGTTGATACGCTTGCACTGCGTGGCAagttgcagacgctgaaCCAGGTTTTCTGTGACCCCGAGAAggtcaaggtgct
gcacgGCAGTGACATGGATATcctgtggctgcagcgcgaCCTTGGGCTGTACATTGTCAATCTCTTTGATACGGGTCGTGCAGCGCGTTTGCTCGAGTAT
CCGCGCTTTTCCTTGGCGTACATGCTCAAGCGTCATTGCAACATTGAGGCCGACAAGCAGTACCAACTCGCAGACTGGCGCATGCGACCGCTCGAGAAGA
ACATGGTCAAGTACGCTCGTGAGGATACGCGCTATCTGTTGTTTATTTACGACCGTCTCAAGAAGGAACTACTGCAAGCTGGAGCAAAGGCTCGCGAGAG
CCTGCTTTTCCAGGCACTGCAAAACTCCAGTAAGTTGTGTTTGCAGGTGTACGAGAAGCCCCAGCccacggaggaggacgctCTAGCCGTCGGAGATAAA
CTCAAGGGGACAGTGAACATCCGCGAGTTGTCCGAGCTTCAGAAACGTGTGATCGCTGCTCTTTACCTCTGGCGCGATCGCATCGCTCGTCAGGAAGATG
AATCGGTGGCCTACGTGATGCCCAACCATGTGTTGATGAAACTTACCAAGCACCTGCCCGTGAGATCCGATGAATTGTTCCGCGCTTGCCACCCTGTGCC
GCTGCTTATCCGTAAGCACGCACTTCAGATCACAAAAATTATTGTCGCTGAGAAAGCAAAACTTGCTGAGGAAGAGACGAAGACGCAACAAGAACCTGAA
CCTGCGATCGCTGCTAAACCCACAAGAAAGACGTGGAACGAGGATGGAGAGGAGCAAACTGTGACTTCATCCAGCCTGAAGCGCGTGGGTCGTGCTGAGT
ATGCTCCTTGGAAGAGTGGGCAGCGCAAGGCTGGCGTCGCtgatgctgacgctgctacgactggatcttcttcatccagcgatATCAAACCGATGGCTCT
CGGAGTTAACATTTCCGAGACTGTCGCCGAACCAGAGACAGCAGCCACACTGCTCGAAAAGGTGAACGCTATGgttgccagcaccacgttcacTATTGCA
GAGAGCGAGGTGGTCGAGACAGCTGCGCCTCAACCAGCATCGTTGTTATCTGAGACCCCCAGCAAGGTCGACAGCAGTGCCGATGCTTCCAAGCCGAAGA
TCCCCCAGTCCATTTCAGAAGCTTATAATATGCCAAACCGATCCAAGCGGCGGAAGACAACTGCCGTGGacacgtctgcagctgctcaagTCAAGAATCG
TGCAGAAGCGTTTATGCAGAAGGTTGATGGTAATGAcaacaaggacgaggacgagagtGGTTTCCAGGGCTTCGACTACGCTGCAGCCAGCAATCAGGTC
ACAGGAGCCAAGTTCCAgttgaagaaggacgaggatgaaggcCGAAATGGAGGACGCGGCCGAGGTGgccacaacagcaagaagcaggcagGCTACAATC
CGTTCGTGGCCATGAGtggcaagggcaagaagcccaaggACCCGAACGAGCCCAAGGCTGCTCAAGTCAAGAAGATGCACCACATGCCGAGAAGTGCCAC
GTTCAGATAGATAAAGACGTCATGGACACCTGATGAACGGCTTTCAGTTAGATAGACCTAGTTTCAGCAAATACACATATGCAGACATCACCACCATTTG
CTAAGTAAAAAATCCCATATTGCGCGATGATTGGTGGAAAAATCGTTCCAAAACTTTTAGCGCCATTTTGGAAAAACGGACCAAGCAGCTTGCACGATCT
CTCGATGGCTCGTAGCGACGCGCTCAAACGCGTCTCGCCCACGTCGTTCGAGTCAGAAGGGGAGGGtgccgccaagaagcttAAGGCCTCGGTGGGTGTG
GCTAgtgaaccagcagcaacggtGCGCAGCGGGCTGCTCGAAGCGGAGGACAGCGAGTCGAATTCCGTTGTGGCAGGGGAGGGTGCTCAAACGGCCACTT
TGACGACCAATAATGGCGTAGACCATACATGTAACGATGGGGGGCAAGGTGGGTACTTGTAGACGGACACTTTAGCTGTATTTTCATGCTC