Description :
From Genome Similarity Track
Location :
Scaffold_388:667- 2537
Transcript NameFunction/comments
g11471.t1POM59271.1 LOW QUALITY PROTEIN: Copia protein (GagintPol protein) [Phytophthora palmivora var. palmivora

Sequence
1870 bases(100 bases per row)
ACAAGTGCCACTAAACGGACAGATCCAGTGGGGAGGGAGTCGTAGGGGTTGTGGCTCTGGGGGGTGGCATGAGGGTCCACGTGCGAGCAATAGGGGGTGG
GGTGGAGCAGTGTCGGAGCAAGCGCAAAAGAGCAAAGACGGCCAGGAGCACGCCTCGAGCACGAACGGGACGCAACAGCACCCTCGAGCGTGAAACGATT
GCAAGCAATTTGCCCCCAGGCAGGATTGAACTACCGACCTTCCGCTTACTAAGCGGGTGCTCTACCACTGAGCTATAGGGGCTCTTACAACCGAACGCAA
CATACCATTTTTCACAAAATAGAAAAACGCACTACCCACAACACAAACCCATCAAACAGACTCACGCACATCACCCACCTCCACAACCTCTCCTAGCTGC
TGCTTCGCCCTCCTCCACTTATTGCCGCGACCCACCCCCACTTACCGATCCTACCACCCGCATACCACATCTACTGCATCACGTGCCTGTCAGCCTACCA
GCCACAGAGCCTACCAGCCACAGAGCCACAGAGCCACAGTGCCCGGCATGAGTCTGCTTCCGCACGCTGCTCCACAAGCACCACAAACCGCACGATCTAC
CTACCTACCATAAGTAGAGCAGTCTTGCACCGGCCTCGGATATGCACTCCTATTGCCTTCGCCAGGTTGACGCTCACAACAAATAGACCGCGGCAGGCCG
CTACACGTGCAATCTGAGCCTGGCCCGACCGCTACAAGTGCAAACTCGCCATCTTACTAATGGCAGCGAACAGTTGCAGCAATCACGTACACTGCGAGCC
AAAGCACTGCGAGCCAAAGCACTGAGAAGCCAAAGCAGAGTTACTGAGTTACTGACTGAGCGGCCGACTGAATGACGGGTTGAGCGTCTCAGGTGGCAGC
TCGTCCGGTCTGACATCCGATACAAGTGCCACTAAACGGACAGATCCAGTGGGGAGGGAGTCGTAGGGGTTGTTGTTAGAGGGTGCTGCGTGTGCATGTG
CGTGTGTGCACCAGGTGTGGGTGCAAGGCGTGTGTGCGTGCGCGTGCCTCTACGCGTGTGCGGGGGGATTTGTAGCGGCGTCAAGTGCTCATGATGAGAC
GCGCAGGTTGCGTGCGCGTGAGAACAAGCGTGTGGGAGCGTGTCCAAGTGCTGAAGCGGCGTGGACATGCGTGTGGGTGCATAGTAAGAGTTAGATATGT
AGGAGTAGGGTGTGCGTGACTTTGGTCATGCAGTATGGTGTAGTGGGTTAAGTGCCGGGTCTTTGATCCGCAGGGTGTGGGTTCGAGTCCCCACATGGAC
GTTTTTCTTTTTGCCGACAAGAGAGCGTAGGAGGCAGGCTAGCAGCTAAAACTCACTCACTCAATCTCACTTTTGGTTTTGCAATCTCGGCCCGAAGCCG
TCTTCTAAGCTTTCAACTCTCCGCAGCTCGTAGCCCAACTTCCTTTTGGTTATGAGCCCAAGTACCGACACCAAGTTCAAGGTCGAGCCTTTCGACGGCT
CGAACTACTCGCTGTGGAGCTACAAGATGAAGATGTACCTGATGTCCAAGGGATTGTGGGAAGCTGTCTCCGGGGAAGCCGGATCGACGGCGAAGGAGCA
ACAAGCGCACGCGGCGATTGTGCTCAACCTGAATGACTCGCAGTTGATGCACGTGGTGACGTCCACGACTGCGAAGGAGGCGTGGGACACGTTGAAGAAG
TTCCACAAGACTCAAGACATGGCGAACCGGCTGTGGCTCAAGGAAAAGTTCTCGGCGTTCAAGTTCACGGCGTCCTCCGTCGGCAAGCACGTGACGGAGT
TGGAGAAGCTCGTGATGGAGATTAAGAACGCGGGGTGTGAGCCAACTGAGGAAGACGTCTGCGCGACGAT