Description :
From Genome Similarity Track
Location :
contig_234:667- 19361
Transcript NameFunction/comments
g14915.t1hypothetical protein
g14916.t1hypothetical protein

Sequence
18694 bases(100 bases per row)
GATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGT
CCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTT
GTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTAT
TTCACTACCCGCCGAGGTTACCCTCGGCAAACCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGGTTCGCGCGAAAGCGCAAT
ATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAG
GGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGAGTCATACCGTTCGGTAGTGAGATT
TTCTGCGTGTTCCTACACGACAGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTATCGTACCCTCGG
CTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCC
CAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCT
GGATACGCTCGGCTGCGTTGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGT
TAGGGGCGACCAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTAT
TAGGCGTGACTGCCGGTACCCTTCCTTCTGAAGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGG
TTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCG
CTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGAGTCATACCGTTCGGTAGTGAGATTTGCTGCGTGTTCCTACACGACAGAACCAAGGATGAGAT
AGGCCTTAACCGTAAATCAGAACCGAATTTGCCCTGAACTACGCAAGAGCTTCACCTACGCAAAGAAACTGAAACTACATTGACCCTACAAGGTGTTGGC
AAAACAAGGATAAGTTGATCTAGATGTTGTGTAAGTCTGGATAATATATTGATCAGATCTTACCTACACTAGTGATCTATTATCAAGTGCAGATCTCAGA
TCCGACGGAGTTATTACTTGGCCCGAAGATCTCTCGGTTTCTCAACCCCCAGAGCCCCTGCTATTGGAAGCGGCAAGAAACGCAAAGGAAGGAGATATCC
ACACCCCAAATGCAAGCCCCAGTGGATCAAGTCCAGGCCGCCAGGTCAGAGCTCGATTGAATCGCTCTCAATCTGGATACAGGACCGGCAGCAGAGCGAA
GACTTCCGCGTTGCTCCACCCCATCTCCGCGTCCCGCCAGGACGGTCAAGAAACGCACCGCAACATGTCTTCGGGATACTCAGAGAGCAGCTCCAACCCG
CCAACGGTACACAAGGTGAGAAGTTCAGCTGATCACGGATCATCGGAGGGCCCCCTCCGTTAGTTGGTGTCTGGGCATTGTTGGAAGCCGAATCCAGTCT
TAACCACATTTCGATGGATCCCACTACCTCACATTGGTACCATCCTGCTGAAGCGTCGACGATCCAACCTTCTGCGGGTTGACACATGCACTCCATCCGC
GCGTAGTTTGTTCCAATTTAGGCCGTGACAGAAAGGTATTCAACTGTCAGTTACTTGGAAGGAACGTAGAAACAAGGGCTAGACAGGATTGAATTCGAAC
GTGGCGACTTTTTAGATTGCCGATAGGTTGAGGACCAAGCTGAAACAGCTTGTCAGCTGCTAATTGCTTCGTCCGCAGAATGAGTCGTGGTGACGGTTCA
GGAGTCAATCCAAACGCCCCCATTCGGTTGGACTCGTTCACACATCCCTCTGAAAGAACGTTGATCAAAGGGCCCATTTCAAACGTGCTCGCAGAGTGTA
GTCTCTCTTGATAATCCGATGAACTGTTCCACAAGGTTGTTGGTCGTAGCAAACCCAGGTTCCGAGGAACAGCACTGCCACATCAAATAGCGTGAATCCA
GCAACTGCGTCTTGAAATAGGCAGCGAAAACATTAAGTTCGGGTTGGGTACTCCACTGCTTCAAATAGAATGCCTTGCATTTGCGTGAATTCTGCAAAAT
TGAACAGAAGTGCATATCGTAAATCTGCGCCAGGACACAATTCGCTACTCAATTCTGAAGCGATTTCGTCCGTTTTTGAACCTTTTTCACGGTATGAAAG
AAGCACATCAAAAAGATGAAGTTGGAGTCGTACCGGAATACATACTCCAATCCGTTCAACTGCTCGTCTTCAGCGTCTCCCCTCACAAATGTCAGCCAGA
GTTGCTTCCTGGTAACATTGGTGTAAATAGAGTGGAATGAATATAACGCCATCGCATACACGCTTCCAACACACTGCGATATAATGCAGAAAGCGACCAA
GTGAAATTTGTGCGAGCGGTCTGACATGCCCAACACTAGCACGGGATAACCGTTCTGCGACGGTTTGAAGATCGCATTGGCATGAAAAATGAAGGAACCA
GGGTCCCGATCAAGACACGCCGACAATTTTCTGGTAGTAATCCCCACGGCGATGGGTTCTTCCTCCGAACCATCACCGACGATGAGCCGTCCATCGGTAG
TTTTGTTATACATAAAAATAATCAAAGCCGATTCATCGCTATTCCCATCGTAGGTTATAGCTCGAACAACCTTCAGTATGCCCTCGTGATAATAGTTGTA
TCGAAGCTGAGCCTTCGAGTAGTAGTTGGCAAAGTTCTGAACCGCACGCAACCGTGGAATCTCATTGACTTGTTAGTATTAGTGTGCCGGATCGTAGAAC
AGGTTGTTTTTTTTTCAATACGTTCTCGACAGAGGATATTTGCACCGCATCAGCTCAATGTAGCTAATCATATGTCTTGCTTTTTGTATGCTGTGCTGGT
TTGTGAACCGCACGGAACAGAGCAAATCCTCTATCTTGAGATGCGGAGGACGGATGTTATGCACTGTCATGGGCTTTGAACCTGTCAGCTTCACCAACGC
AGTCGCTCGAGCGGGTGCGTGAAGCGAGTCCATGCATGTCCGGCGAGGTGCCCGTGATGCAGGGCCGAGCGCTATTTGCCGAGCCAGGTCCGGCGACGTG
CTCCTCAATGGGACGAGCATTGAATTCACCAGGTGAGAGAATTCTTCCCCGCAGAAGCGGCCCTCTTTGAGTTGCATTTCACCCCCTCCTCCTACCGGTT
CTTGACATGCTGTGCAAATACTATATGTCAAATTGACACTGTCAGGGAGCGGAGGCGCTTGACGATTCATCGACGACGAACGCTGTTCATTCAAGACTTG
AAGCCGACCAGATCCACCAGGCAGAACGGTTCTGCCAGAACTGAACAATCCGTACATGTGATCAGCGAAACATTTGCAATCCAAATGCCGAAATTGGATA
GGTCCTTTTGCACCACGCCATCTGCGGCAACAGAGGCTAGAGTCTGCCAGACTCAAGGGTGGCTGCCGTACATGTAGACCACCTTGATTGATTGAATAGC
AATCGCGACGATCACCATCCTAAGCACTGAGATTTGAGAGAATAGTAAGCAGCGTTGCAAGCACTGAGATCAGTGTTTAAAATATAATTAATATACTATT
TCTGAAGCTTGACAGGATTCTTCAGCATTGCTTAGCTCAGTCCAGCTACTGGGGCTAAGAAGGTTGTCACGTACAAGACGTGAACAACAGCTTGTGTTCA
CTTTTGAAGTTGCAGTACTTGTATAAATAAATGCAAACCCGCGCGGCACAGAAAGATGCCATGCAATCGTAAGTGCATGTACCAAAATCATCCGCCTCCA
GCGCAAGAGCAATTACAGCCCTAAGACCGTCACTTCAACTAAAAGCGAAGAGGAAAGAGAGAAGCCGCTCCTTAACGAGGTACAGTACCCGACAGGGTCG
TCTGGTGGAGGTAGAAGAGGAGAAGGACTGAGAGGACGAAACCATGGAAGTTAGCCTCGTGTCGCGAACCCGGGGTATTCCTTTGAAGGAAAGTTTATTA
ATGATGAAAAATGAAGCAAAGTGGAAACTGGGTAGGGCTAACTACTGTCCTCGACTCAGGTCTCGATACTGCTCTCGGCTCCCACCCCTCACATGGCGGA
CGTGTGCCTTCGCCCACTGCTTTCTCGCGCTGCGTGCAGCGAGGCACGTCGCGTCTTGAGTCAATCGTCTTCTTAGCCGCAATTGGCAGCGCACACCGCG
CTGTCGAAACCAGTCCCCACCATAGGCCACAGTAGAAGACACGTCATAGCTCGACGCAACCACAGCTTGACACGTCAATCTGGCGACACTGCCTCCCCAA
AGCTTGGTCGTGTTGGGCTAGTTGAGTTGTTGTAGGAAGTCCGCATCACCACAAGTAGCGGCGTACTCACGGACCTTCGCAGGGACATCTTGGAGCAGAG
TATCCAAGGGTTCCCATGAATTTTCGATGGCTTGAAGTACAACCCACGCAACAAGCAGTTCCCAACGATCGAACTCCTCATTGAAACGGTGCTCCAGGAA
TCCGCTCACGCCCACCACCATACCCTGACTGGATGCCAGCTCCAGGAGCTCATCAGTGGTGTTTAGCGTTGAGTCCGCGTAGAATTTCAATCGTGACGCG
TGCACCTCGTAGACACGTCCCGTGACCAGGTGCTCAATCTTGAAAGAGTGAGGCAACGCCTCGGTAACCTTGAAAGAGCCTACCCACTGACCCAGCAACT
TGTTGTTGGACAAACGCTGGTCGATTCTCGACCACAGCACAAAATCCCCGACATCGAAGTTCACTGGCGTGCCTTTGTGCGTCATCATGTCTTGAAGACT
CTTGCGTTCCTTGGCGTCAGTGACGTCACGGTGCATTTGGTGTAGTGACGCGCGCACATTCTCGAGTTGATCGCCCAAATCTCCAATTTCAATGACGCGC
TCTTCAGTGGTTTCGCTCGCTGGTGCAACCACCACGTCCAGTGCCGATGAAGCAGGGAGACCAGTAAAACCTTCAACTGGAGAGTGTCCCGCTAGTGACT
GCACCGCAGTATGGTCCAGATTCGCCTGCAGAGCTGGCAGCAAGTACGGACATTCGTGATAGTCCAAAGCATACTCCAACAGCAGTGCCCGCAGAACTTG
AAGGACATCTCTGTTGAGTCGTTCAACGGCCCCATTGAGCCAGGGAGAGTAGACAGGTGTGAAATTCTGCTCAACCTTGAGCCGAGCTGCCATGTGTCGC
ATCATCTCGTTACGGAAATGAGCTCCTTGGTCCGAAAGCAACGTCTTCGGAATTCCGTACCGAGCCGCCCACATTAACAACGCTTCTGCTGCCACGTAGG
CTGTCGGCGTTGCACACGGAAACAATTCACAAAAATGTGAAAGACCGTTCTTAACCACAAGGAGGTATGCTGAGTCTCCATAACCTTCGCCATGACTTAA
GAAGTCCCAATGCACCACTTCATTGCGTTCCGTCGGAGTCAGCAACGGGCCATACGGGCGAGGAATCAGCCGCGAACCCTTCACATGCTTGTAGAGTAGG
CACTGGCGGACAAACTTGGCCACTTTGTCCTCCACTTTGGTGATGTAAAACCGCGCTTTCAGAGCCAACACCATTGCTTCCTGACCGCGATGACCCTGTG
GCCCACAGTGTGCGATCACAAAAATTCGCGCGAGTAGATCCTTCGCTCCGGTTGGGATCCATGGAAGTCCACCGGCGACCAGCACGCCACTCTCCTCGGA
AAGAGTAGCTTGTAGTCGAGATTTCTCACGGGCAGTGTCTGCTTGGGCACTCGCAATGTTATCCCAGGTAGGAAACACAAAATCCGCGTCCATGAGCGGG
CGAAGCGCTGACAACTCGACCACGGGAACGACATGACGCCCTCGCGTTTGCACAGCAGCCACTGAAATGGATTCCGCTTCTCGTACGTGCCACCTCGACA
CGATGTCTGCCCATACATTGTCGTCGCCCGATATGTGTTCGATCCGATAGTGGAGCCCACACAAGCGCATTGCCCATCGTTGCAGCCTGTCCCGAACGTG
CTTCTTCAACTCGTCATGAGGGGCGAATATGTAGATAAGGTTTGCGTGGTCGCAAAAAAGTCGAAATCCTTTTGGACGAAGAAGTAAGTACTCCAGATCG
TTGCATGCCTTAACGATCGGATAGGCTTCCTTCTCGATGACAGTCCAGTTGAGCTGCGAACCCTTGAACATGCCACCTTTGCAAATAACCAATTGGTGAT
CCTGTTGCTTGACTGCGACGCCAAATTGCCATTGGCGGACCTGGGTCACCACGATACTGAAACCGGAGAGTGATGCATCAGTGAACACGCACAAATCTGC
GTCCTGGTCTGGGTGGACCATCAGTGCAGAATCTCGCACCAGCGATACCACGTCTTTGAAGGCATCTCGTTCCTCGTTACTCCACTGAGTGGTAACCTGC
AGTGCGTTGCGGTTCCGCTTGCCAATCTTCTTCTTCTCGGCTTCCAACTTGGCATGGAGCGGTGCAATTACGCGGGCATAGTCTGGCAGTGAGTCATGTA
GCCAGTTTGTGGTGAACACAAAGCGCTGCAAGTCGGCGACTGTAGCGGGAAGGGGGAGCGTTGATAGCGCATCCATCCTCATCGGGTCATGTCGGACACC
ATCCGCCGAGAAATACCGCCCGCACAAGAGGATCTCCAGCTCGAAAAGGGAACTCTTCTTCATGTTCACCTTCAAGTTCGCCTCTGCAACAATTGTAAAA
AAACTTGCGCAGCACTACCAGGAACTCAGCAACGGTCGGTGCAAACAAAATCACATCATCCACCCACACCAATGCCGAATGCGGGATGAGCGGAGCCAGG
AGTGTCTGCATTTGAGATTGGAAATGTAGCGCCGAGTCCATGGCGCCTTGAGGCACGCGATTGGGCGTGTAAACTCCATCCGGCGTCACAAATGAGAACA
ATTCCTGGCAATCAGGATGTAAGGTGAGCTGCCAAAAGCCGTGAGTCAAATCGAATCTGGCGAACACCTTCTTGCCAAGCAGTACTTCCATAACCGTAGC
AGTTGACGGCATCACCCCCGCAATCGGGGTGGTCAACCGGTTGACAGGGCGATAGTCGATGGTGAGGCGGAACTTATCGCGGGACCCAGGCTTCCGAACA
GGGACAACTGCACAAGCCCAGCGCGCCGCGTTGTTCTTGGTCACCAAACCTTCCGCCACCAGAGACTTGACATACTCGCGAATAAACTCAGCCAGTAGTG
GTGCATACTTGCGGGGAGGACTTCGATACGGCCTCGCATCTTCACGTAGCCTGACATACAGTGGCTCAACAGACGCCGCCGCACCAGAACTTACAGCATC
GCGCCAAATTTCGGGAAACAGCTCCAGCATCTCACGCACTGCTGTAGTGTGCTCATGGGGTAGACCGTTAGCAACCGCTCGATCCAGCAATTCATCCAAT
GTTGTAATGGGGGTCGATGCATCCCCAGGCAGCTCGTCACCCACTGGAAATTCCTCCTCCTCGTCTTCCAACAACGTCGAATCTGCCAATTGGGCCAGAG
TCTGGTCAACATCGATGCCCAAACGTTTCAAAGCGTCCTTGCCAAGCAAAAACTCGTCGCCTTCACCCTCCAATACAAGGCATGGCACGGCGCGTAGGTT
GACAGCGTCTGCGATGGCCACGAGCTCGAGGTCCAATACTACCTCCATTTCGCAAACTTGCACGCTCCCATCAGCTAGTGTCACACTGACGGGGGAATCA
AGGGCACTATCCCAAGACCAGGTTGCACGGCACGCAGCGAGTCTGCCATCGCACTGGGGATCACGCTCTGGTCAGCGCCAGTGTCCGCAATGTACGCGAC
CTCAAGAAGCCCGTTCACTCGCACCATGTTTCTCGTTGCTCCAGCGCGTACCGCCTTTGAGCGAACAGAGCCTGCACGCTGCTCCTTAGCGGCCTGATAC
TGCTGACGCGCGGCTTCCTTCTGTGTGTTCGTCGCTGTGGGGCAGTCCATGGGCCAATGGGCGTCTCTACACACCAGGCAGCCGTCTTGTGGTGGCGGCC
GAGGGGGTCGGGGTGTAGCCACAGCGCCACGAGGTGCTGTCGGCGCAGGAGCTGAAACACGGGAAGCTCCGTCTGTGGCGTTGGGTTTTGATGCCGAACT
GTCACGGTCCGGCTGATGTTGCACCTTTCAGTGAACGGCGACAGAACGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGT
GACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGGATCGTACCCTCGGCTGTGTAGAGCCGGCTAT
ACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGA
GAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGT
GGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTG
TCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTA
CCCTTACTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAAC
TCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGA
AGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTC
TGTGTGTCTTGGTTGCATATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGT
ACCAGCAACGGCGAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGT
TCGGACAGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAG
CCGCTGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGG
TTACGACGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACC
CCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCT
GGATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAATACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGA
ACCCCAAGTGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTC
GGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCTGGGAGAC
GCCCCAGAGGGTCGACCGAGGCCGGAATATTTTCGGCCCAAGGTGCGACGTCGTATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGTAC
AGAACGACTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGATGAC
TCATCTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTGGGAATGACAG
TGCGACACCGAGGCTAGAGATCGCTACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTC
CGAGCGTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACC
GACAGCTGCCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTA
CTACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGT
CGTGATGCAAAGGACCACGTCGAGCACTTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACC
TCGAGGATATGATCAATGATATCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACG
CGATGGTGGACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAAC
CGTCGCCGGGATGACCCAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGT
GGAGGATACCCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACT
CGGACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGA
CAACCGTCGGCCGAGGGCAAGTAACGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCA
TGCGCCGCCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCC
AAGAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCG
CCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGC
CTGATGACTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGG
AGACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAG
AGAATGGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGG
ACACTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAAT
TAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGT
GCAGGAGTGGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGG
TGCCCCTGGTGAAGTCGCAGAACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTG
GCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGA
CGAGGGCAGCCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACC
TGCCGCAAGGGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGG
GAACGCAAACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACG
ACTTGGAACCTAGACGAGGGCCAGATAACGTTCGCGAATAGGGCACTGAGGAACCGACAGAACGAGACCGAATGCCGTTGACGACTTCGACCCTCTGACG
AACCCGTTGGAGATAGATGGGTCGACGAAGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCAT
CCCAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTACCCGGGGGACGGTTCAGGTAGTGGAACACCGA
TACCAATACGTCCGAACATTTAGCGAATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTA
CTGGATTATTCAGGACCGAATGTTCTGAACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTG
CGAGTGGGAATGCTCTGCCACCACCGGCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCT
CCGACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGAGCGTCGCCCATCGTGATCGTG
CTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACT
TGTTGACCGACCTGAAAGCCTACTTATGGTTCTGCTCGCTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAGATCTCGGC
ATTCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAGCGAATGATTGACAATGCTCTGTGG
GGTTTCGTCCAACCCAAAGGCTCCACTTCTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGGCAGGGGTGACCGACCCTTCGTCGCG
ACGACTCGAGGAGTCAACAACTCGGTTTGACCAAATTCGAGGCCGACCGCGAGTCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGT
GGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGATATCTGTTTTGGGTCCGAGACT
TTCGACGCGTGCCTGGAGACGTTAGACCGTCTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGG
TGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGG
GATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTC
ACGCCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGG
AGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGT
CCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACC
ATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCA
CCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCA
GTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCG
ATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTA
TCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGA
GACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGC
TGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTC
GACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTC
AGCTTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGAC
ACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGAGCGGCGAGCGAGACGAAGCGAATGGTGTGACC
ACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAG
AGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGC
AGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGA
GAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTC
GAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAG
TCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGT
CGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTT
TCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAAT
GATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTAC
GCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTT
ACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCG
AGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAG
CGACGTGAGAGAGCTGCAGTACCGAATGTCGATGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCTGATCCCACTGTCGAAGGAC
CGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCCCACCGATGGCATGGACCATT
CAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAG
GCCGTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGACGAGGAGTTGTTGCCTGAAGATA
GCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTT
CAAGGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGCGGGCTACTTTATGATTATCTGCGGACTCGGCGCAGC
GAACGACGATTGCAGATGGTTCAAGTCGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCTACGGGGGTGATACAGCCCGTAGCAACAG
ATGAAATTTGCTACTGTATCAAAATTGCGAGTGACCGACTATTGATTGCTACCAAGCCTCTGACGAGGCCTGGTGGCGACGTCGGTTGACGAATGAACTG
CCTGCGGGGATGATGCAGCCCGCAGTGACAGACGAAAACTGCTACTGCATCGAATTTGCATATTTACATGTGACGTGAACGATTTTCGAATGGAATTGGA
TTAAATGGAATTACTTGGAGCTCAAGAACTGCCGCTACGGAGGACTACGAGCTTCGGACGGCACACTAGCAGCTTGAGGAACGAACGGAAAAATTAGTGA
GACCAGACCGAAGCCTAGACCTCAGTGGTCGACGCGATGTTAGCCAAAACATCCAGATCCGACCCTTGAGCAGTTGCCGGCTCGTCGGCCGGTGCTGGGA
CCGAGGAATGACTTGGAGAAGACTCTGAGTCATCATCTTCCTCCTCCACGCCGGCTGACCAGTGACACCACTGACAGAAGCTTGGACAACCCATGGAGCC
GTCACCATAGCCGACGACAAGGATGGATCAACCATCAACCCGGACACCACCTCCGCTTGCGTCATTCCCCGCGGCACGAACAAAGGCACTTGGGGGTTAC
ACGGAGCGAACGTGGTGTTGAACGGGTGGCTAGCCGGCGGGTCGACCCAACAATTGCGCCACGGCTGCCTGTCGTCCAACGTGGCGAGCTCTCC