Description :
From Genome Similarity Track
Location :
Scaffold_1994:667- 1945
Sequence
1278 bases(100 bases per row)
AGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTA
CCAAAGCATGGAGAGAGCGGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACT
GGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTATCAGTAGGTCGCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTTT
GGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTTCCAAGCAAAGTGACCGACTCTACCGCAACGGTAGCA
TCGCACATTGTTTCCCTGCGACTACTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCACTACCGGGCGTGGCTGTGG
CCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAG
AGATAGGTCTTCACAGGCCCATCTCTGAGTCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACC
GTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGTGGCTCAAACGCTTG
TCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGACCCGAGAGTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGAC
ATGGCGAACGCGACCTTCGACAAGGGGTCGACGATGCGTCCCGGATACGAGTTTCTCGCGCGAAGTGCTGCAGAACGCCTCGCAGAATATCACGACGTCG
ACGTCCAGCGGAGCGAGGCAACGTGGAATAGCTGAGGTACGCTGCGAGGCCCACGGAGAAATCTTCTCGTTGAAAGACGACACGAAGCTGGGCAGCAGCC
ACACGTTGTACACCATGACGCGCAGCTTGAAAGGAATAGGACTCCTCGGCAATGAAGAGCGAACTATTGGGCTCGCGTCTTCAACTGGCTGTGGTTCAGG
CGTCGTAGCTGCCTCTGGACAAGCTACGGCGCTGTGCTCATCGTTGATGGTGCCTAGCTGGAATACTGCCGGCGAATA