Description :
From Genome Similarity Track
Location :
Scaffold_113:66685- 69454
Transcript NameFunction/comments
Phypl_g3431hypothetical protein PHYSODRAFT_344464

Sequence
2769 bases(100 bases per row)
AGCAGTGGAAGCTCAGCCCCGATGGCATCGCGCAAATGGCACTTCAGCTCGCATTTTACCGCACGCATGGGAAGGTCGCCCCCACGTACGAGTCGTGCTC
AACGCGCATTTTCCACCATGGACGGACGGAGACGATTCGCTCGGcaactcctgctgctgaggccTTTGTCAAGGGCATGGAGACcagtgctgcagttggc
ACCCAGCGAGAACTTCTAGTCGCGGCAGTTAACCGTCACGTGGAGATGGCTAAGATGGCGCAGAAGGGATTGGGCGTGGACCGCCATTTGACTGCGTTGA
ACTCGATCGTCAACCAGAATGGAATCTCCAGCGACTTCTTGGCAAGCCCGGTGCGCGCCGAGAGCACGAACTTCCTGGTCTCCTCGAGCAATGTGACGAT
GCCGTGCCTGCAGTACTTCTCCTTCGGTGCTGTCGTATCTCACGGCTACGGCGTGGGCTACCTGCTTCATAACAAGAGCATTAACGTGAGCCTGACGAAC
TTCAAGGACAGCGGCATCTCAGATGGCAAGACGTTTaagaaggcgctggaagGCTCACTCGACACCATCAAGGCTCTCGCGGACAGCCCCGCCCTGTGAT
AACGTGCAGGAAGGAAGACTCAGTGAATGGAGGGGGAAGGAAGTCTAGCGCTGATGCAAACGAAAAAGATTGTCACCATTTTGAGGCTCTTTGCCTCTCT
TGCGTGGGAGTGAACGATTCTCTTGCATGTTCAGCTCTGCTTGACAACGAGTGGGCTGATCCAGAAGCCCCTACAGAGCGAAACGAACGAGTACTACCGT
GACTACCACTGAGGAAAGtatcagcagcttggaggTCTGCGTGGTCAAAGCGGCGTCGGTCACGCATGTCGAGCAGTCAAACGTGTAGTTGGACAGCATA
TTGCAGAGCGAGCACGACGGGCTACACGACGGGCAGTAGCAAGCCGCCGATCCGTTCGTGAGTACCTGGCAGTCCCCGTCGCCACAATCTGTGGTCGTGC
ACGCGTCTTCGACCTGTAACGCGTTCCGTAAAGAAAGTTGAACACTCGGATAGCGAAGCTGGCACTTCCTAAATTGTTGGTCGCCAAGTGAATTCAAAAG
TGAGTTGAGCGAGGCATCAGCCTCTAGAGCGCTCTCCTCATTCCTAGCAGTTCTACAAGTACTCCTCTACCGTGGATAATACTGTTAGTTGCCTTTCCTT
GACTTCAGGTCAAACCCGCATGGATTCCATGTGTGTTGGGTTGCACTTAGTGCCAGCTGGGCTAATGCACGCTAGCAAGAGCCCAAAGTGTGTGGATAAG
GCTTGAATACCCATCTCACACTACAGACCGCACCGCACGTGTCACCACTGTAGCCGGCTGCGCAGACGCAGTTGCCTGTGTCAGTGGTGCAGGTGTTGTT
GTGCTGGCAAGCTAGATCATTCGTGCATCGGGTGCAGCGCTCATTTGCCGTGTCCTGCTTGCCGTCGTACTCCTTGCCATCAAAGCCCTCTTTGCAGACA
CACTCGCTATCCACGCAATCTCCGCCCGTGCCACAATCGACGTCGCACGAGTTAGAAACTTCGGTCGAGCACGTGTCGCCCTCGAAACCAGCGTAGCACA
TGCACGAGCGCTTGGAGATTATCTTCCTGCTCTTGTAGGTGCAAGTTCCCTGGTACGTGCACTGCTCCTTGGAGTCAGAGGAGCCGCAGGCGCTGGGGCT
ACATgtgctggcgtcggccgccttGCTATCGCAGTCAGATATTGTCAAATTTGGATGCTGTGGCCGATTGGGCAACCCGTCCTGCAATCCCGCAGCCCAC
GTGATTGGTTAAAAATCAGCCAGTGCGGCATTGCGGAAGATCGTCGCACAGTGTTGCAGAGCGGAGTGCGGAAGATCGCCATAGTGTTGCAGAGCGGCAA
TGTGGCAgtgcagaagctcgtcgtCAGGAGCGTCAGTGCTCTTCCAAGTCGTGGTAATATGACCTGTGCTTGCTTTGTTTTACGTGATGGGGAGGCCATT
AACTTCTCTCGTGTCTCCTGCTAGCTGTTGAACCTGTCAAGCTTGTCGCGTTCGCTTCGTGCAGAGAGCGGTGACACGTGGGGCACGCACACCCCAACAC
AGTGCTCCATTGTTTGTACGCGTTCTACGAATATGGCTTGTCGTGAAAAGACCTTGCCCATGTGTTCACGAAGAGTGAAACCACCATCGGCAACTGGATT
CGGGTCTACGAGTCGACAGGAACGTTCGTCCGCGCGCAAACAGCAGGGACCAAGAAGTTTACGGACGACCACAAAAAATGGCTATGCGAGTTTTACTCAG
AGCGCCCACTAGCCTACTTGGACGAGGCCCAGGATGCCTTCCAGCGCGCACATCATCTTTCTATCTCGAAGTCGTCAGTTTGGCGCATTATTCACGACTG
TGGTTTCACGTGGAAAGTGTTGGAGCGTCGGGCTATGCATATTAAGGAACAAGACGTTTTTCGATTTGTGGAGGAGTTGGGCAACATTGACTGGAGCCAT
TACAATCTCGTTTTCCTCGACGAAATGTCTTTCGACAATCGCGGGATGATCAGAAAGCGCGGGTATTCCCTTAAGGGACAGAAACTTGCCATTCGGGGCG
ACTTTCAACGAAAGCCGAGAATTTCTATCCTAGCATTTATTGGAGTGAATGGCCTTATCGATTGTTTCGATACACAAGGCACGTTCGATCGCGTAAAATT
TGTGGAATGCTGCCAGTACTTTGCGTACTCCACACGCAATCGCGTCCGGCAGTACCTAGGCGCGAATTC