Description :
From Genome Similarity Track
Location :
contig_124:66668- 72030
Transcript NameFunction/comments
g11467.t1callose synthase, putative
g11468.t1callose synthase, putative

Sequence
5362 bases(100 bases per row)
GCGGTAACTCGGTAGCTATGAAGAAGGAGAAGCACGGCATGCAGCGGCAGCTGTCGGCGGCGCCTCCCCCGCGTCGACGCGCGCCCTCCAACTACCAGAC
CGTGGAGGACGTGGCAGCCGAGCGCGGCGTGAGCATCAGCCGCCCGCCCATGGACAAGTTCCAGCCGCAGCAGCCCATCGCCGCGTTGACGGCGTCGGGC
CCCATGCGCCCGCCGCGCCCCGGCGCCGACTCGTTCGAGCTGCTGCAGGCCAAATTTGGCTTCCAGGAAGGCAACGTGCGCAACCAAAAGGAGCACTTGG
AGTGCTGGGTGCTCAACTACGAGTCCCGTATCATCGAGGCGGCCGTGACGCCTGTGGACACGGAGAGTGCCATCCAGACCATCCACGCCAAGTTCTTCAA
GAACTACGTCAAGTGGTGCCAGTTCCTGCGCACGCAGCCGCTCCTGCTCGACACGGCGCCGTACCCCGGGGCGGCGGAGCGCCAGATCGCGCTCTTCCTG
CTGATCTGGGGGGAGAGCGGCAATCTGCGCTTCATGCCCGAGTGCCTGTGCTTCCTGTATCACAAGATGGCGGCCAAGCTGGATGGCCTGGAGAAGCTGC
CCAACGCGCCCGACGGCACGTTCTTGCGCCGCGTGGTGCGCCCGCTGTACTCGGTGGTGGCCAAAATGCGCAACGTCACTCCGCAGAAAACGGCGCGGGC
GTCGACCACAAGAACGTGACCAACTACGACGACGTGAACGAGTTCTTCTGGACGGAAACGTGCTTGCACTTTGACGAGGCCAATGTGGCTGGAGCCGTGA
ACGCGCAGGACTACAAGTCGTTCAAAGAGCGACGTAGCTTCTGTAACCCCATCCTGGCGTTCTTCCGCATCTACTTCTTCCTGCTCGTCATGCTGCACGT
GCTGGTCGTCATTGCCTACGTGGCTTATCGCTCGGACCCGGACGACACGTCGGGGATCCATTTCTACGCCAACTTTTTCACGTCCGACATCACGGACATT
CGCAATCACTCCTTCTACTCCATCTTCATGACGGTCAGCGGGTTGCTCGCTTGTTAAGGTGGTGCTGGACATTTGGATCGATGGCACACGTGTCTTCAGC
CGCATTATGTACGCGGTGTCGGTGTTCATCCGTCTCGTGTGGCACACTGTGTTCTTCGGCCTCTTCACGGCTGTGAACGCGGCGCCATACAAAGAAGTTG
GCTCGAGCGACTTGCTGTCGATGGCACCCGTTTTCATCGGTGTCTACATGGCGCCGATCGTGATCGTGTCCATTGTGCAGATGTGCTTCCACGGTGTTAT
TTGGAGATCGGCTCTCCTGAGCTCGCTGGATGGGACACGTCAACAGTACATTGGTCGCACGATGGGCCAGAGTTGGGGGAATTTCTTGTCGTACGGAACG
TTTTGGACGATCATTTTCTTGTGCAAGTTCTTGTTCAACTTACAGCTGATGGTTAAGCCGCTTATCGGACCCAGCGTCGAAATCTACGGCGTGGATGTTT
CCGCCGCTCAGCTAGAGAACGGTATCATCGAGTCGCAGCACAACATTGCGTTCCTCGTCGCCATGTGGGCGCCGGTGTTCCTCGTGTACATCTACGACTC
TCAGATTTGGCTAGCTATCGCGCAGGCCATTGTGGGTGCCTGGATTGGTTTCCGTCTCAAGATGGCCACTCGGCACGCATTACAGAGTTCGTGAAGCGCC
TTCAGCAAGCGCCTAGTCTTTTTGACGAGAAGGTGGTGTCTGCTGCAGCCCGCGGTCAACTCGCTATCAACAACAACCCGCTGTCATCGAGTTCTGTTGC
CCCTGATGCCAACAGCCGCCTCCGCTTCGCTGTTGTGTGGAATGAGATTGTGAGCAGTTTCCGTTTGTCTGACTTGTTGGATGATCGTGAAACAGCCATC
CTTCAGTACCAGATCTCAGACACTGGAGCCGTCGAAGAGCCCGTGTTCTTGATTGCTGGCGAGGCACAAGCAGCCGCTGACATTGCCGCCAAGGCTAAAA
CCAAGCGCATGAGTGACGGACAGCTATTCAAGGAGTTGAAGAAGGCAGGCTTACTGGGCTGCGCCAACAACTGTGTTGATATTCTGTTCCAAATTTTACG
TCAGCTACTGGGCCCTGAAGATTCGGAGCTGGTTGGCGTCTTCCATCAAATCCTAGCTGGAGGCAGGGTGAGCGGCGTAGTTAACCTCACGCACATTGGA
TTGGTGCGCGAGAACGTGACTGACTTGCTTGCGAGCATTTTGGACTTGCCGGAGCCAGGTGTCGTTCCTGCTGGTGGCGCCTTTGGCTTCCCGCACGACC
AGGTTCTTATAGTCGTGCAACGCTTGGACGCTCTACTGAAAAGCATTGAGCTTATGCTGGAAGAGGAATGGATGGCAGAAAAACTGCGGAAGTCTGCGTT
TGCCAAGATGACGCCGGACCTTGCTTACCAAAAGGAACAGTTGTTGTCGATCTTTGCTGATCGCATTAGTCAGCGTGACTCGAACTCTCCCACCCGCACG
ACGTCGCCAAGTTCGAATGAGAGTGTGGTGTCGCTTTCCACGCGACTCTTCTTTTTGTTGACTTTGGACGCTGCCGATGCATTGCCTCGTTGCCACGAAG
CACAACGTCGTATGAGTTTCTTCTTGAACTCTCTTCACATGAAGATTCCGACGATTGATTCGATTGCAGCGATGAAGTCTTTCTCTGTAGTTACGCCGTA
CTACAACGAAACGGTGTTGTTTTCGGTGGATGAGTTGAACGGACGTGTTGACTCGAACCCGCTTTTCCGCAAGGTGGAGCAAAAGGGCCGTGATCTCAGT
ATTTTGAAATACTTGATCACCTTCCACGATGACGAATGGGGTAACTTCCTTGAGCGTGTGGGCGTGGCTTCTATGGACGAGGCGCTTGCAGAGACACCGA
CGCAGGTTCGCCTCTGGGCTTCAATGCGTGGACAGACCTTGGCACGTACAGTGCATGGTATGATGATGTATGAAGATGCACTCAAGATGTTGCGCTGGCT
CGAGATTGGCTCGGACGAGAAAATCTCTCACTTGGAAAAAATCAAGCACATGGATCGCATTGCGGGTCTTAAGTTCTCGTACGTGACCAGTTGCCAGATC
TACGCCGATCAACTTGCAGCTGGAGATTCACGCGCGGCAGATATTGACCTTCTGATGCGCAAGTACCCGAACTGGCGTGTGAGCTACGTGGATACGATCC
GCCCACCCGCAGGCAGCGGCACGGAGCCTCGTTTTGACTGCGTACTGGTCAAGTCGGATGGTGATGAAATTGTTGAGGTGTACCGTTATGAGCTTCCTGG
CAACCGCTAGTTGGCGAGGGTAAGCCGGAGAACCAGAACATTGCCCTGCCTTTCACACGCGGTGAGTACTTGCAGACGATTGATATGAACCAGGAGCACT
ACTTCGAAGAAGCGCTCAAGATCCCCAATTTCCTGGCGACGGCTACGGAAAACGGAAAGAATGTCACCATTATTGGCATGAAAGAGCACATTTTCACGGG
CCGAGCATCATCTTTGGCACACTTTATGACGTTGCAGGAGTTGGTGTTCGTGAGTTTGACGCAGCGTGTGCTGGCGAATCCCCTGCAGAGTCGTATGCAC
TACGGTCACCCCGATGTGTTCGAGAAGGCATTTGTGATGTCCAATGGCGGTGTATCGAAGGCAAGCAAGGGTATCAATTTGTCCGAAGATGTGTTCGCTG
GATACAATGCAGCCCTTCGCGGCGAACATGTTACTCACCAAGAGTTCATGCAGTGCGGTAAGGGCCGTGATGTGACGCTGAGTCAAATTAACGCTTTCGA
GGCTAAGCTGTCGAACGGTAGTGCTGAAAGCTCCCTAAGTCGCGAGTCGCACCGGATGGGTGCTGGCATGGATTTCTTCCGCTTGAACTCGATGTTCTAC
GGCCACATGGGCTTCTACATCTGTAACGCTTTGGTGGTACTCTGTGTGTTTGCGTACGCGTACGGCAAGGTTTACATCGTGCTTCACCAGGAAATCCAGG
AATCAGCCATCATCACAACGAGCTACCTGGACGACCTGGCAGAGGTGATGAACACGCAGTTTATCTTCCAGTTCGGTATGCTGATGACTATCCCGCTGAT
CGCTACACTTTTCGTGGAGTACGGTTGGCACCAAGCCGTGGTTAACTTCGTGGAGCTGATTGTGACTCTTGGCCCAGTGTTCTACATTTTCGAGACTGGT
ACGAAGTCGCACTTCTACGACGTTGCTATTATGCGTGGTGGCTCCAAGTACCGAGGTACCGGTCGTGGCTTCGCCATCGTTCGTGAAACGATGGTGAACT
TCTACAAGGAATACGCCGCTTCTCACTATCGCAAGGCTGTGGAGCTTATGGGCTTAATGCTTATCTTTGGTACGTACGGTAACTTCAGCATCGGTACGAA
CATACTGGCCGAGTATTGTGCTACTGCGGACTTTGACTGCGACACCAACCCAGACCAGATTCCGTCGAACATCACGCTGCTGAATTCGTACAGCTCTAAG
GGTCAAGATTATGGCATTGCCTCGTTTGCGGTATGGTTGCTCGGCGCATGTTGGCTGCTTGCGCCATTCCTGTTCAACACGGACGGTTTGGACTTCTCCA
AGACCATGGTGGATGTCTCCTACTGGCTCTCGTGGCTCATGTCTGTCAAAGAGGCAGACGGCGATGAAAGGCTTCTTCCGGACCACATGAGCAGCAGTCC
TGCAGGCCCGAAAGACACGTGGAACGATTTCTACAACTATGAGGCCAGCCTCATGTACCCGATTGGTCCGATGAGCCGCTTTGTCTACGCAGTTCGTGAC
TTACGCCACCCGCTGGTCATGTATTATGTGTTCATCTTCTCGTTCAGCCTGAGCGACATCGGGATGCTGTTGGCTTGCGTTGGTGGCATTTCCGTTGTGC
TATGGATCGGCGGTTTTTGGTTTGGGTATGTGCTTGCGCAACTCGGCTCGTGTTCCGCGTGCAGTACTGTACGTGCTGATGGTGATAATTATTGGAGTTG
CTCCATTTGTGGTGGGATCTATGCAAGACTGGGACAGCATCAAGTCCTTCTCGTTGACGGTTGCCATTTTTACGGGGCTCTTTTCTCTCCTGCACTATCT
GCAATTACTACACGGACTGTTCGGTCTGCCTGTTGCTAAGTGGGGTCTCGTTCGCGAACTTGCCTTCTTCTTTGATGTGATCGTTGGTTTGTTCTTGGCA
GTGCCGCTTTTGCTGCTGTCGGCTTTCCCGTTCATGAAGACGATCCAGACGCGTATGATGTACAACGGTGGCTTCTCGCGTGCCTTGAGCTCCGGAAGTG
AATTTGCGGCCTCGCTCAGTGTTGTCGTGGGTGGTCTGGGAGGTTGGACGTATGGCTGGTTG