Description :
From Genome Similarity Track
Location :
Scaffold_10:666615- 677889
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004537Protein of unknown function
Pytul_DAOMBR144PYU1_G004536Protein of unknown function
Pytul_DAOMBR144PYU1_G004535Similar to CCT6: T-complex protein 1 subunit zeta (Oryctolagus cuniculus)
Pytul_DAOMBR144PYU1_G004534Similar to vti1A: Vesicle transport through interaction with t-SNAREs homolog 1A (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G004533Similar to MMTAG2: Multiple myeloma tumor-associated protein 2 (Homo sapiens)
Pytul_DAOMBR144PYU1_G004532Similar to flad1: FAD synthetase (Danio rerio)

Sequence
11274 bases(100 bases per row)
ATTATACCACCCATCGTACTCCACTCAGACTTCACAGTTTTTACAGAATATAAACGTCGTCGCTATAGTCCTCGCACGGTTCTTCAAAAAAGTCGTCATC
GTAATAGTAGTCCTCGCACGGTTCTTCAAAAAAGTCGTCGTCATCGTAAGAGTCGTCGCACGGCTCATCCGGAACGAAGTCACTGCTGCCGTAGTCGTTG
TACAGTTCACCAACGTCCGCAATGCATACGGGGTCGACGAGAAGGAAGCAGCGTCTCAGCAATGGTGTTTTAGAGACAACACTTCGCCTGGGGATTCTGC
TGAGGATCAAGTATTCGTCCCAATACGTACTCTCTTGTATTTTCGGACGGATTCTCAATAAACGCACCAAGTCGCGGACACGAAACACAGGCCCAAGATG
GGTTGTGTCAATCGGGTAAAGCCTAACATCTTTGTGGCCGTTTTTCAGCAGGCATTTTGCGAAGCTCGTAGCATGGATTTGATTCTCAAATGACGACACA
AATGGCGTTGGTTTCCTGTTATACCAGTCCAAATGCAGTTCGACTGCATCTTTGAACTTGTCCTTATCGTGAAAATCAGGCGACGCTCGAGCACACAGCG
AGTTGTTCCCGTACTGAATCCGCCACAACGTGCTTGGAGGTTCACACCAGAAGGTTTTCACAACTTCGAGAGTATTTGGATCCATTGCCAAACAAAGAAG
CGTCGAGCACTTTGCGTAGCAAGCTGGAGAGAGCGCGATCTAGCCGAAAGACTGAAGGCTCGTCAAAACAGGGCAAGGTAAATCGCCAACTGATCTCCAC
CCTCCGCTTTCTACGTCGCCTTTTCCTTTGCTGGCGGTAAGTTGCTGCCGCTTTTCACTCTTCCTGTGTTCTTCGCATTCTCTTGCAGTTTGAGAACGGG
CGGGATTATTTTAAATGTTTTCTGCCTACCGTACCTAGTGTTCTCCGAAAATTTTCCTTATCTTGCAGTGCGCGCAGATTCTTGGGCCTTGGATCGCTTA
TGTTGAAAGAATTGCCGTTGCGTGTGCTGTGTCACTCTTGATTAGAGGTACTGTGGGCGTCGTCTCAAAATTCAACCCATTGTCCACAGTGTTGATCGGT
GTCCTAAGTTGCTACTACATCACAGGCAAATCTAAACTCAGCTTTATGTGCAAAGCATACAGGCTCTACATTGATGTCACCAAGATGGGCACGCTGATGG
CATTTCTTTTTAAAATTTGTTATCGACAGATATTCGCACTCATACCACTCACTCTTCAGACATTGTCTTGGACAACACACGTCCCATGCTTATGCCACCC
CCTTACCATCAACACATGTAATAGTCGTCTGAATCCGACGAATCTGAGTTGTCCAACTAGCTTCTGTACCATTGCTTCGTGTGGACGATACTCGACGAAG
GCACTTCGTTCAGAATCAAGTACTCGCCAGAAAACACGCTCGGGTCTTGGTTAAGATAAATGCCCAATCAGCGCACCAGGTCGTGGATGCGGAACAACGG
ACCAATGCGGGCCGTGTTGATCGTGTAGAAGCACACCTCCGAGTGACCATTCTGCAGCAACCGATTCGCCCAGTTCTCGGCATGCATGCGGTCCCCAAAC
GACAACACAAACGGTGTCGATTCTCTGTTGCGCCAGTTCAAATGCCGCTCGGTCAGGTATTTAAATTCGTCCTCATCTCGGAGATCAGGCACGGCGCGCT
TGCAGTGAATTGCCGCTGTGCTGCACGCGCCACAACGTTCTCGGCGGCTGCTCGGACTGGAACTGGTTCACGACCTCAATAGTATCTGCGTACATGGCCG
AATGTGGGCAGCGTGGTCGAGTTGGTTCGTTACTTAATTGCGATCAATGAATCGAATGCGGCTGCTCTTGTCGACTGTCGCGCACTCCCCAAAGATACTT
TCTGGAGTCGTAAGAGCGCTTCCACAGGGGCCGTTGTCAATGCAACACGTGGGAAATGCGAACTGTGCTGATGATCCAACTCACCCCCTGTCGACACACG
CACAGCGCACCTTCCCGCGGACCTCGTCGCCCCCTTTTCTTGGGGCTCGCGTCACTTTCTACTTCTCCCGCGTCCCACGTCAGTGCTCCAGATTGACTGA
CCTTTGATGATACAATCCTTAAGTTTACAACTGAAGTGCATGTCTACAAATGAGTGACCAGCACTCACTATATCAACAAAAAGGGGCAAAGTTCATAAAG
TCATCAATATAGAGCGCTCCAGATTAAAACATTCTGGAGCGATCCACAATGGATCTCGACTTCCCGCCTGCTTCCTCACCACAGATCGCCCAAATGAATA
GAGCCCCAAAGCGGTAAGTAAAGAAAAGCGAGCTTGCCTCAACAGCGTAACTTACGTCCGTAGTATACATTCAGGAGTGCATTCATAATTTGAGCAGTCA
GAAATTTTCACGGAAAGCTTTTAGCCAGAAGGTAAACTACCGTTAGTTAACGTGGATCTGCGTCGCCTTGCTGGTTTGTGTGGGGAAAAAAGCTCGCTTT
CTCCAATCCAAAGCTGCGCCCGAACGCCACACGAACGAAGCACACAGGCGCGTCTCCCTCTCTATCCACACACAGCATGAGCTACCGCGGCATGAACCCG
AACGCCGAGATCGTGAGCAAGTCGCAGGCGCTGCTCGTCAACGTCAGCGCCGCCAAGGGCCTGCAGGGCGTCCTGAAGTCCAACTTGGGTGAGCAAAGTA
TAGGATCTTGTTGGTTGATGTGGCAGCAACGCAAGGGGGAAGAGCTACGCTCGTTGTATCGGAGGAGAGAAAACACTAATGACGCTTGAATGCATGTGTG
TAGGTCCTCGCGGTACACTCAAGATGCTTGTCGGTGGCGCCGGCCAAATCAAGCTCACCAAGGACGGCAACGTGCTACTGCACGAGATGCAGATCCAGCA
CCCGACGGCGGCGCTGATCGCGCGTGCCGCCACGGCCCAAGATGACATCACGGTACGGCATTTATTTGTGTGCTTCATTCACCTCTCGGCTGCATGGCGT
ATCCATCTTCATTGCTTTTATATAATGGGTTTTTATTTGGACTGACGCTTGATGCTGGTGTGCGATAATAATGCAGGGCGATGGTACCACCTCGACGGTC
CTCTTCATTGGTGAATTGCTCAAGCAAGCCGAGCGTTTCCTCGCCGACGGTTTGCACCCGCGTATCCTCGCGGAAGGCTTTGACCTCGCCAAGGACGAGA
CTTTGCGCATCTTGGAGACGTTGAAGGTTGCGAACAAAGACATTTTGAAGGATCGCGAATTGCTCTGCTCCGTCGCACGCACTTCGCTCCGCACCAAGCT
GGACCAAAAGGCGTGTTACATGTTCTATCTTGCGTTTATTCGCCCATTTTTCCACAAGCATTCATCTGACATTCTATTTTGCTTGCTGTAGCTCGCGGAC
CAATTGACAGAAATTGTCACTGACGCTGTGCTGACGATCGCGCAACCTGGTCGTCCAGTCGACTTGCACATGATTGAAATCATGCACGTACGTACTCTAG
TCTCCTTCCTTTTCTTCTCTCATATCTGTATACGTTGGATTTATATGCTGGGCCTCACTGCTCTTCTTTTTTTAATGCATTTTCAGATGATGCACCAAAG
TAGCAGTGATACACGTTTGATCAAGGGTCTCGTGCTCGACCACGGCTCGCGCCACCCAGACATGCCGACGTCGCTGGAGAACTGCTACATTATGACGTGC
AACGTGTCGCTCGAGTACGAGAAGAGTGAAGTGAACTCGGGTTTCTTCTACAACAGCGCCGAGCAGCGCGAAAAGATGGTCGAAGCCGAGCGCAAGTTCA
CGGACGACAAGGTCAAGCAGATCATCGAACTCAAGCGCGAGTTGTGCACGGACGAGAACAAGAAAAACTTTGTGATTGTGAACCAGAAGGGCATTGATCC
GCTCTCGTTGGACATGCTCGCGAAGGAAGGCATCCTGGCGCTTCGTCGTGCCAAGCGCCGCAACATGGAGCGTCTCACGTTGGCGTGCGGTGGTATGCCG
ATCAACTCGACCGAAGACATGGACGAATCGATGCTCGGCTGGGCCGGCAAGGTGTACGAGCAGACGCTTGGCGAAGAGCGTTACACGTTCGTGGAAGACG
TCAAGCACCCGCAGTCGTGCTCGATCTTGATCAAGGGACCAAACGAGCACACGATCGCACAGATCAAGGATGCGATCCGCGATGGCATCCGTGCCGTGAA
CAACGCCATCGAAGACCAAGGTGTCGTGCCTGGCGCGGCCGCGTTCGAGCTAGCGGCTCACGAAGCGCTGAACCAATACCGTGGGTCGGTCAAGGGTCGC
GCCAAGTTGGGCGTCCAGGCGTTCGCGGATGCGCTGCTGGTGATCCCAAAGGTGCTGGCCGAGAACTCGGGCTTGGACGTGCAAGACACGCTGATCGCCG
TGCAGGAGGAGCACGCGAACTCGGGCGAAGCCGTCGGCATTGACTTATTCACAGGCGAACCGATGCTGCCGGCGCAGGAAGGCATCTGGGACAACTACCG
CGTCAAGCGCCAGTTCATCCACTTGGCAACCACGCTTGCGTCGCAGTTGCTGCTCGTCGACGAAGTCATGCGCGCCGGCAAGAAGATGGGCGGCGGTGGC
GGCATGCAGCCCGAGGAATAAGCGAGGGACGTTTTAGTACGTAGTAATTTTTACTTTTCTAGCGATAAATAAGGGAACGAAAGAGAGACAAAACAAAGCA
TTTTCACACACACGCACGTATGACAAAGTGAAATAATTCTAGAAGAGTGGCAACATGCATTGCACAGAAGGGTAAATGCGGCTGGAATCTCATTATATAT
TGAGCGCATGATAGTTTTAACGACGACGCAGGAACAACAAATAAAACACGACGATGTCTGTGATCGCGAGCAGGATAATCATAAACCACAAAAACACCTG
CATGCACATATGCACAAAAGTTATCAGGTTTTTAATCCTACAACGAATGAGCAGTATGCACCATGCACATACATATATGCCGCTATTCAATTACGGCGTG
TACGCAACATACCTTGCGGCGATACGATCGGTCGGCGATCTTCTTGAGCAGTGAGCGCACTTCGCCCGTGATGCTCGACGTTTCGTGGAGCATGCCCTTC
ATATCCTGCATTTGCGACCGCTGCAACTCCAGATCCACGAGCACGTTTCGTGCCACTTCCTCGGATTCGTACATGACATTCTTCGTGTGCTCGATCTTGT
CCGACTGGCGCAGCAGCGTTTGCACCGACTACTCCACACATACCAAACAGCAACACACACATTTTGTGAGTTCCAAGCGTTCACACCAATACATAACAGC
CATCACTGTGCAGAGTAGTTCGCAACGATCGTTATGCATCATCCAGAAATCGCTGTGCAAGACGAGCGGAGTTGTTAAATGAGGACGCGCCATTGCCATT
CACACATACACACACACCTGATCATTGGAAAACGTGCTGTAGTTGTTCATGTTCGGGTTCGCATCAGGGCCAGGATATTTGCTGCCTGCGGACGTGGGGC
TCCGGTTCTTCAGGTTGCGTCCATTGGTGTTTCCATTGGCATTGGCATTGGCATTGCTGCTCGTGTCGCTCAGGTGGAGATCGCGGAAGCTGCCGTGCAT
CCTGGTGCTCAGATCTTCTTCACTCTCTTGCTGCGTCCTTTTTTCCGCTTGAGCCACTTGGCGCTGGTCGACCCTCCACGAAAAAAGAATGAATCAGGAA
TCTCCACATAAGGGGGTCCACATTATTTATATTTAAATTAACTAGTGCGCCACGCTATTTTAGAGACTACATGAATGGAAAGAGCGCACATAGTGCGGTA
AAATGAGCTTCGGGAAGACCAACTACCGCTCTGGCGGCACGCGCGGCGGCGCCGATCGTATGTGCTGAGCAGCGCTGCGTCACATTTAGATGATGCCGCT
TATGCTATTGCGTACCTGTGCTAACGCTTTGTGTCGTTATATCGCTATTTGTGCTTATTTTTTTGTGCTGGAACAGAGTTCAAGTGGGAGGATGTGAAGA
ACGATAAATACCGTGAAAACTATCTGGGGCATTCGCTGCAAGCGCCTGTGGGGCGATGGCAAAAAGGTATGACTGCATGCATGCTATTGCATACTTAATT
TGTATGCTGTTGAACTATAGCTAAGCGTGTTCTTATTGATTATGGCCTGCGGTAGGGAAGGATTTGACGTGGTATGCGAAGACGAGCAAAGAGCAGCGCG
CGTTGGAGCTAAAGCAGGAAATCCTGCTGGCCAAGCAACGCGACGAAGATCTGATGAATGAAGCACTGTACGTGATGTGCATGCCGTTATTGCCCGCAAT
AATGATGGATGTTGCGTGGGTACTCATTGTTACTACTGCTGTGTTGTTGCATTGTAGGGGTCTTGCACCACGTCGCCGTCACGAGCCGACGGAGCAATTG
GATGCTTCCGAGATGAAAGAACTGCTGAAACGCGGCGAGTCGGAGCGCGATGGCATGGATACTGAGCGTGTAGAAGGTCTCGGAGCTGCTCCTGTGATCA
CTGGAGTCGAAACCGGTCCAAAGAAGACGCTCGCGGAGCGATACAAGGAAACGCTGGAATCGGGGAAGCAAGACACAACGTTTGCGCTGCCTGGAACAAT
TGATGTGTCAAACGCAAATGGGGACGCAGTGCACGATAAAGAATCGAAAGAAGAGAGGAAAACGAGAAAAGCAGCAAAGAAGCAGCAACGAAAGGAGGAG
AAGAAAGCCAAGAAGGAGCGCAAGAAGGAGCGAAAGGAGAAGAGGCACTCCAGCACATCGCTCTCGCACCGTTCGAGTCGAAAGTACAGCAGTGACGACG
ATGAGCGAAAAGGTACTGCCGATCGGAGAAACGATCGCTCGAGATCGCGCTCTCGCGGCCGCAAGACTGAAGCCTCTCGGTCTGCTTCACGGTCGCCGTC
GAGAGGAAAGCCGTCTCGCCAGCGCTCGCGTTCGCGCTCGAGGGATCGAGGCAGAGACCGAGTTTCCGACGCGCGCGGATTTACGCGCCGCACGCCGCGT
TCGCGCTCTCCATCTCCACGCACTGCCCATGCGTCGTCGTCGAGTCGACGCCGTGAGCGCTCGCGCTCGTACTCTCCAGAGAGTCGACATGATCGAAGAT
ACGAGAGACGCCGCTCTCGATCCAGATCCAGGTCGGCACGCAGGGATTAGATGCAGAGAGCGGAGATGCCGCGGACGGCGAATGGCGTCGATACCAAGTA
TGTTCTTTTTTTTCTCTTTTATACTCGTAAAGATACAATTGGCTTTCTTGCACCAAGAGCGTCTGCGTTCTTTGTATGTTTTCTAGTCTTCTATGTGTAT
GTGCTGTACTGACTGATATTGTGCTGCTTTCCCGAAGCTTCGTCCTTGGCTTCGTCTTAGTCGGACTTGGAAGACGTATGCGCTTTCTTCTGTCGCCCAC
AGCGTTCTGAGTTTCCGTCTTTGAGCTCGTAAGCAGGGAGGTAGTGGCCTTCGAAATCTCCTTCTTTCTGCCAAAGCGCTGGGTTCTGCACCGTGTCGTA
AATATTGCCCAGCGACGTGTACCTATCAGCATCAAAGTTCCATATTCAGTTAGCATTCGCTTGCATTCATCACAGCACAGTTATGCAATATGCGCAGTGC
CAGTTTTCGTAATTTCGTACCCGTGGTCGTAGAGGTTGCAATACTCTAACTTGCACTCGCGCAGGAAGCTCCAGACGTCGGCGTACGTCCATCGCAGGAT
CGGATTCACGCGCAAGAATGCGGGCCACCCAGGTGTACTTGGCGAGTAATGTTCCAAGTCCTCTGTGTGTGGGTCGCCGCCGCGAACCCCCATGTAGATG
CCCTTGATGCCCAGTTTCTCCAGAATATCCTTCACGCCCTCTACAAACGAGCACTTGTACACGTGGCAGTTCAGCGAGTAGTTGGCGACGCACAGTTCGA
TGAAATCACGCACTTCCGGGAACTGATCGTGCGAGTCGAAGTACATCACCGGCACGCGCTTCATGGCCTGCTCCACGCGCGCCTCCAAGTCGTCTTCATC
GAGAAGCGCGGGGCTCACAAAGCATTGACGTGGCGAAGTCACCGTTTTCGCATTGCTCGTGGAAGCTTCCAAACGCGCCTTCTCCGCGAGTTGCGCTTCC
TCGAGCACGCGCTTTGCGATGACGATGCGCAGCAAATGCAGCACGACGGTCGAGTCCTTGCCTCCGTTGAAGCTGAAGCAGACGCCCTCAAGCCCAAAGA
TATCGATCGCGCGGTGGATCACGTCCAGCGCCTTTTGCACGCGCGCGCGCGTGTGTACATCCGCGCTCGCGTAGAAGGCATCGAAGTGCTGGATCGTCTC
GCGGATGCCCGTGCGAGTAGCCACCATTCTGTATATCGCTAGCGCCACAGAGAGAGAGTGCGCGTCGCTCGTCTATGGGGTTGCTTCCGTCGTCGACCAC
AGGGTGCGAAATGCGCACGTCAACGTCCGAAACGTTAAGCACTCTGATTAGCTGAAACTCGAATTGCGCCGTATATTCAGCCAATGATAATTGGATTTCT
ACTTTACAGGACGGTCTTGTATTGAAGGCATTGGCTCTGTCAAGTCTTTTTCTGGAAGGCTAAAATTGTCGCTGAAGTACAGCCGAAATACAGCTAATTC
GTGTAAAGCTGTTAAGTTCGGAAACGTACTTAATATAAAGGAGTCTTTGTCAAAATCAATTTTGACACAATGCGCGATTCGTTCGAGTCCCCACACTCCT
CTATTGTGGGTATAACGCGTATTACAGCAATGTGTTCACACAATAGTGCAGGTGTCCGTCCATGTTTACTTGCGCGGGAATGCGCGGATGTTGGTTCTCA
ACGATGTGCAAGGAGCGACTCTACGACCAATGAGTCATGCTCGAGGCTATTGTTGACGACCCCCCGGCGCACGTGGACTGACTGCTTGTTGATACTCTAC
TTCGTACCCAGCAGAGAACCATCCTGGATACGCGAACGCGACGTTGCACTCATGAGATTCAATTTGTGGGTCGTCCCAACGAAAGCCGCGCCGCCTGGCT
ACCTGGTAATGCGGAACGCTGGCTTGTCTGGGTGCTCCTCACATGAACACTTCTCTGTAGTGCATGTGAGCTTAACCTCACATGCTGTTGGCATTCTCAA
ATCGCAGGTCCGTGCCTCCATGACCAAACGTCATCATAATCGGCAATTATAATAGTCCGTAGGCATACAGACAGTGGCCAAGTTTCTCTTGCGAAATCAG
CGAACAACTAACGAGTATTTGTGTGCTTCTCACATGCGTGCAAGTTCCTTTGCGAACGGCGTATGCACAACTGTGATTGGCATGTTTATGTGTCTTGTGT
CTTGCAACGCATGCTTCCATGGCCAATCGCCGTCATGCGCACTAACAATAATGGACAGCTTCATGCAAGCCGAGGAAAGCGATAATTTTTTGGCGGAACG
TTCCCGAGAACCAGGCAGGAGCGGCATCTGGTGGTAGCGCACCCACAGCGGGCTCTCCATCCTTTACCGTCGGAGCATTTCCACACACAATCACGCCGTT
AAAGCGCATCTGTGGCGTGTGGCCCAGCTGGTCACTCTGACTTTATCTGTTGTGTGGCACTACACGGATTGAACACCCACAGCAACGCTATGGTTCAGTT
GACGTCGCCCAGTAATCTAACAGGCAAGATGGGTGTTTATACAGGTCTGGACAGTAGTTGACTTCAACATTGACTTAACTGGACTGGCTTTTCACGGTAA
AGGCTGTTCGTCGGACCGACTATTCGGTCCAGTTGATTAGCACCAGATGGCCGTAGAGGATACGCTTTAGCTTTTCGATCTCAGGTGGTTATGACGAAGT
CTTCTACTGCCTATGCTATACGTCTACAGTATGTGGCTATGCTGCAGAGCGCGGGCGGATGGCCACCACCCTGGTCTGAAAGAAAACGAAGCGCAGGGCG
TCTCTCTGCTCTCATTCTCCGTTTTGCTTCCTCGTGAGCACGATCCCAGCCACCAGTGGATAGTAAAGAACTTCATCGGCAAAGTTCGCTCTCGCTCGAC
TACCTACAGCGCTAGTACGATACAATGGTGTTTGCTTGTGTCAAGAAGATCACGGTCGCCGTCGCGGTCATCGCCGCGCTGACCGCTCACAGCGCCGAGG
CGACGTTCGGTGGCGCCTACAATGGCAACAACGCTGCCCAGATTGGCTTTAGTGGTGGCTTCAACGGCTTTCCATCCATGGGCGGTAACAACAACGGCTA
CAACAGCAACAACAATGGCAACAGCTACGGGAACGCTGGTTTGGCCGGCAAGAACCTTCGAGGCCCAGTCGTAGATACACCAAAGACCGTCGCGACCACA
GTTACCGCTAGCAGCAACAGCAAGAGCAACAACGACAATTCGCCGCAACAGAGCACCGACGACTCGTCGACTTCGATTAAGAAGCCTTCGGGCCCAGTCG
TGGTCACTGCGCCGCCAGCTGTGACTCCTACTGCGGACTCGTCGACTTCGATCAAGAAGCCTTCGGACCCAGTTGTGGTCACTGCGCCGCCAGCCGCGAC
CCCTTCTGGGCCTGGTCCTTTCTCGACGGCAAACAAACCTACAAACGGCAACCCAGCCGCGCAGTATCAATACCCATCGAAGGAACCAACGACGACCAAG
CCATGCACTAAGGTTCCGGTTGTCGCGACACCGATTCCTTCGACCAAGTCGACTGCACCGCCTACACCAGCAACTACCGCTCCAAAGATCACGCCAGCTC
CAACCACGGAAGCGCCAAAGATCACGCCAGCTCCAACCACGGAAGCGCCAAAGATCACGCCAGCTCCAACCACGGAAGCGCCAAAGATCACGCCAGCTCC
AACCACGGAAGCGCCAAAGATCACGCCAGCTCCAACCACGGAAGCGCCAAAGAAAACGCCAGCTCCGACCACTGAAGCGCCAAAGCAAACCCCAGCTCCA
ACTCCAGCTACGACAACTCCAGCTCCAAAGGCTACCCCTGCTGCTACCACCCCTCAGAAGCCATCAACTCCTACTGCAACAACCCCACAAAGCCCACCAA
CTAACACCGGTGGTAATGGCCCAAACCCTCCAGCTCCACAAGCTACCCCTGCTGCGACGACGCTAGCTCCAACTCCAGCTACGACAACTCCAGCTCCAAA
GGCTACCCCTGCTGCTACCACCCCTCAGAAGCCATCAACTCCTACTGCAACAACCCCACAAAGCCCACCAACTAACACCGGTGGTAATGGCCCAAACCCT
CCAGCTCCACAAGCTACCCCTGCTGCGACGACGCTAGCTCCAACTCCAGCTACGACAACTCCAGCTCCAAAGGC