Description :
From Genome Similarity Track
Location :
Scaffold_35:6666- 7938
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011375Similar to SCPL48: Serine carboxypeptidase-like 48 (Arabidopsis thaliana)

Sequence
1272 bases(100 bases per row)
TCTGTAACGACACAAAGAACGATGCTGGGTACATCCAGCTCCCGAACAAGAAGGACGATCACTACTTCTACTGGTTCTTCGAGTCCCGTAGCAGCCCCAG
CACTGATCCGTTGGTACTGTGGCTCACGGGTGGACCTGGTTGTTCCAGTCTCATGGCACTGTTCACAGAGAACGGTCCTTGTCACGTGCTCCCGGACCTC
ACGACGACGATCAACCCGTACTCGTGGACCAACAGCGCTAATGTGATCTGGTTGGACCAGCCGACGGACGTCGGATTCTCGTACGGACTCGACGCAGATC
TGGACCACAACGAAGACGACGTGCAGGAAAATATCTACTGGTTCCTGCAGAGCTTCTTGGACACCCATCCAGAGTTTATCGGTCGCCCACTGTACTTGAC
GGGAGAAAGCTACGCTGGTCACTACGTTCCTGCTGCGGCCCACTACATCTGGCAGGAGAACGAGCTCGCCAACAAGACCAACAGTACTGTCACTCCTCGT
CTCAACCTACAAGGTATTGCTATCGGGAATGGACTCGTGAACCCTGTTATTCAGAGTGAGCATGCCTTGGATATGGTCAACAACACGTACAATGTCACCT
TGCTGAACCCAAGCGACCTCGCCGAGGCTGAAGCGGCGTTGCCAGAATGCACAAAACTGCTGGAAGATTGCCAGGATGACGCCGACGCGTGCCCAGAAGC
GCTAGGATTTTGCCAGGAAAAAATCATGGGCCAAATCGCCAAGGCCAGTCGCAACCAGTACGACATTCGTATGGAGTGCCATGAGGAGGATTCGACCAAG
TGCTACGACATGAGTCACGTCACGACGTACCTCAACTCGGTGCCTGTGCGCGCGTACTTGAAGGTCTCCGAGGAGCGTGTCTGGGAAGAATGTTCTGCAA
AGGTTGGTGCGGGTTTTGCGGAAGATATCATGCGAGGCTTCGACGAGTACGTGGCGGATTTGCTCAACTTTGCCGACGTGCGTGTTCTAATCTACGCCGG
TGATGCCGATCTGGTGTGCAACTGGTACGGCAACCAGGCGTGGACCAAGGCGCTCGAGTGGCAGTACAAGGAGGAGTTCAATGCCGCCCAGGAGCACGCC
TTTGTTGTCGCGAACGCCAACGGAACTATCAATGCCGGGACGGTGCGCACTTTTGAGAACCAATTCACGTTCGTTCGTGTGTTCAACTCGGGTCACATGG
TGCCACAGGACCAACCTGTGGTCGCGTCAGAAATGATCAACCGCTTCCTGCGCAACGAAGCGTTCTAAGCGA