Description :
From Genome Similarity Track
Location :
Scaffold_68:66656- 67931
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17398glutamyl-tRNA synthetase

Sequence
1275 bases(100 bases per row)
CTCCTTCTTGGACTTCTTTGCAGGGTCCTTGGGCTTCTGCTGCTCCGGCTGCGGTTTCTTCTCTTTCTTGGGCTTGGGCGGCGGGCCGAAGTCCTTGCCC
GTCACCTCCTTGAATTGCGCCTTGAACGCCAGCAGCTGCGCCACAGCCTCCTTGATCTCGTCGGCCTTAGTGGCGTCTTTGGCTGCCTTAAGGTCGCGCA
CTTTCTCGCCGGCAGCTGCGATCTGCGCGGTCAGCTCGGCCTCCGTCGCCATGGTTTGTGATGATATGTGTTGCTCCTATTGCGCTTGACACGGCAGAAC
CACGAATGGAAAGCGATCTTGATCCGTTGTTCATGTATCCCACACTCACTCAGGTGGTCCACCTTCACTGGTGTTCGACACACTGTTTTCATGTCACAGG
GCAGTAAATCGTGCGGACGGCACATGGAAAAGTGTGTTTATCACCGCAATATTCGTATTTTGCTCTGTAACCCGCGTCCCTTTTAGGTTTGTATGGGTGA
AATATACAGTAAAACTTTCATGTCTCATACGAAAAAAGTAGAATCTCCTGTTTTCCTCCCTTCTCCCCCTGTTCTTCCTTATCTTGAATTGAGTAAGCAT
GACAGGGGAAGAAGCTTCTTTGTGGAGTGAAAAAACGCGGTATCTGGGAGCGTACCGGTTTTCCAAGTAATCCGAGCAAAGAGCACCACACGAATTCCAC
ACAAGTTTTCTACGAATCCGATATACCGTTTTTTTGATTTCACCCGAAAGCCCAGTACAGTAGTGGGCTAAAAACATTGAAGTATTTACCCACTATAAAC
CCTAAGTACGAACGATTCCCTCGCTAGTAATCCCTAGGCTTGGAATACTCCCTCAACAGCAATAAACTAGTCTACAAACCCAAGATATTATTCCCTCTCA
AGGCCACAATCACCTTACTAGATTCCTTTGGGTGTGTATGACTGTTCCCATAGTTAATCACCCCAGAATATGAATAATTGACTTCAAATGTGTTTCCTTT
TACAACTGAAGGGTATCAATCCACATGAGATGCTTTTTAATTGCTTCTAGCTCAAGGTCGTCCTCAATACTAAGCTGCATATCGCCCTCGCCCGGGTTTT
CCGACCCGGTCTCAGAGCCATCTATAGCCAATTATTGGTCACCAACTCTACAGAAGTGTTTATCTGTGGAATCTTCTGTAGTTGTGTTCTCATCCGGCGG
GTTCAGAAGCTTGTCCACGGACATTGGATCCTTAGCGTGCAGACGCGATAACATCGTCGCAAGCACAGCGGATAT