Description :
From Genome Similarity Track
Location :
Scaffold_243:66647- 68889
Sequence
2242 bases(100 bases per row)
CTTACCTGTAGATCCATTCAACCACTTCTCGACATCCGCGTGCGCGCTCTCTACACGAAGTTTTCACATTACCGTGAAGAAGAACACCAAGAATGTAGCA
ATATACTAACATTTCCTTGAAACCAGCCAATTTTTCTTCATATACCGCATTACATGAGCTGGTTAATAAACCCTCATCAAATCATCTGCCGGTCATACTC
TGTCGTGTTTTGAGCTTATATTACAGTTACTCGCGCTGTAACTATTTGCATCTTGGTGGTGATCTTCTTGTTTACATGGCATCTAAAAGTAGTGTCCTTG
CAAAAGGAAACAGCTGCGTAGAGCGTCCATTTATGCCATCCCGCGTTCAACAACATATGTTTTCGGTGTAGTTATGCTAAGCATTTCAATCACCCACCTC
AGGTTCTACTTCGCCCAGGGGTATTCTTTCTTTCCTCTTTGACCATATATTAATACGATAAAGTGTAGCTGTTGGTGGTCACAGTAACGCCAGCAATGTG
CAACAGCGGTAGTCTAAATAGATTGGTCTTGTAAGTGGGGTAAATTAAAAATAACCGACTTGCGCAGGCGGTATTTTTCCTGACAGAGGGAGACACAATA
AATAGCTAGGTGAGATGTTGCTCAACATCAAATTTTGCGAAGTACGGTGCATTTTGTATTTTTCGTTGTTTGCTGCTAGAATCTCAAGCAAGTTTGCAAG
CGGAGGCCACCCCTAGCAATCTGTGGTGTTCATTTGCACAAATGTTATATATGTCGCGCTCAACGACACCTGCAAATCGTCGGGGGGAGGCAGCGATGCG
ACCAGCGCTGATACCTGCAAGCAGAGTCGCAATCATCGATTGTTCTTGTTCTTCCGTAAGCGCCCGTCCAAATGGATGCACCTGTTTGTATGCAAAAAAA
TTATGGTTATTCTATTCATGGGTGACTAAAAACTACCACCGTTCTGGTTGTTCTTGTTGGTTTAGGGTGATGCGGCATTTGCATATGCGCATGTGCTGGT
AGTTCTATGTACGGAAGTATTATGAAAGTAGTGTACGGCATATTTAAGTGCGATGTAGATGAGTTGGCTACTATCAGCTGGGAAGGTTTGGCAGAGCTCA
CCCAAAGGCCATCGGTTTCGATACCCGGTAGCGTGCAACCTTCAGGTCCTATTGTTAAAGGTTCACCAGCACTGTCCTTCCAGGCAGTGACGCCCCGCAT
TTATGACTGTAGTCCACATTCGAAGAAATGTTGTCCACATCAGAGAGAAAGAGAGCACGGCAACGACCGATAAATGTTAAATTGGAATAAATGGTCAGCG
AGCGAAGTATATGATTTTTCAGAAGGCGTAAAAAAGCAAACACGGTAGGAACGAGATAAAACACATAATTCAACTCACTTCTGGTTTTGCTGCTTCGAAC
TCAAGTATCATCCGCCCACAACCATCACACAAACACTAAAAGTTCTTGACGTCACTGTCATGTGATCGCAGCTGAGAAGAAGAAGCCAGTGGCGCGGCTA
GAACCGATTTGCTTACAAAGATGCGCTAGACCTGAATCTGCTTGCGACCGTTGCATGAGCATTGAAGATTGACTGCTGTAACCTCACCATCCCTGCGGTT
AACGAACCTTTGTTTCGTTCTATTTTTGTAGTATAGCCTTTCGGCAGTTTCAGCTTGTCAAGCGCGTGACGGGCTCCGTCCACAAATTAAAAAAATTTCT
TTTGTGAGCTAGCTAAGGCCTTCAATGTTTCTTCTCACGAAGGATGTCCGGGGTACGATATAGTAGGTGGCATGAAATGAAGGACGTTATTGCTAAAGTG
CGTAAGAATAAAATTTGACAATTTAGAGACTTTCAAGTCCAATTACTGGTTTAATGTATGAGGTGAAGGCTCATTAGCGGGTCGTTTGAAAATTTGAAGT
AGGGTAAGTATATTAGCATTACCTGTACTACGACCCACCATCGACCGGTACGTTTAACCTTTCTCTAACGTTTATGCATCAGAAACATAGTAGTCAAATG
TTGGGTTAAAGCAGCACTGCGATCATGAAACTGAAGGAAGATATAACCATAATATTGTTCTATTCAATCATCGAAACATGCAATATACTATGCTTGCACT
AACTGCGATGCAGTGGTATGCTGTCGTGTATCACAAACAAGAAAGTTAAGGTAGTGTCACTAAAGCGTGCTACAATTAGAAAGGTCGAGTGCTGGCTATC
GGCAACAGGGCTACCGACGTTGCTATGATTCATCAGGAGAGT