Description :
From Genome Similarity Track
Location :
Scaffold_11:66640- 71408
Sequence
4768 bases(100 bases per row)
AGCGACTCTGAAGGTGACCTCAGCCTCTCTGGTGATTCTCGGAGTCCCTGTAATTCACTGCTGACTCCTAAGGAATTTTCGGCACTTCCTGACATCCACA
TACCCCGCGATCGTTGGATTCCAGGGTATCGCGATCGGGTTCCGCGATCGGCAGTAGATGTGTCTCTTTGGTCCGCCCGAAGCGTGAGCCTGATCAGCGT
ATCGGAGCTGGACATAGACTTGTTCTATCATCACTTTCCAAAGCCGAAGGGATACATCTTCCCGGTCCAACTGGGCAAATTTCGCCCTCCTCTGGAGTCG
TCCTGGTCATCCCAGTTGATCACGTCGACAGAGGTTAACCAATTTTACGATCAACAACCTTGGGACCTTTATGATCAAACCATAGACCCGATCTCCTTCA
AGCCTTCCGGCTGGTTCGAAAAACTGGTCGAGGCTTATAAGGTGAGGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGACACATTTCTTGTGGATCTCC
GCTGAGCAGCGTAAAACGGATCCTGAATTGGCCGCTTTTGCGCGAGCGAGAAGGAAGAGATGATCTCGTGCTGGCCCCCGTTGGAAGCGGGTACTGCAGC
TGATTCTTCAAGGCATGATCGAAGGCCTCTGCGATTTGGTCATTTTACTGTACCCCATGTTTCTACACTTTCCCCGTCCGAATGAAGCTAGGGTGTGGTA
TCCCGGCCTATCCATGCGGCGGACCAAGATACCCAACCTGATCACTGCCTTGTCTATCGATCACGCTACCGAGCGTTGGAGGAACCAGTTTCGTCCTTCG
ATCGCATCCCACCTTGGGTCGTCCCTTCCACGCTTGGTTGGTAAGTTCTTTGATCGCGAGTAATTTACTTGGTCTGTTCCATGGCGCGATCTCTCAATAT
ACTTTCTTCTCATTTCCATTCGATCGCTCCCATAATTCGTATTCCTTCCATCTTTTTCTGTCGTTTCATCTTGATTGCACCATTAAGTCTGCGATCGTCG
CACTCAATTCACATCAATCCCATTTTATCTCCATGTGCAACCTCCGTGCACCCATAACTCTCCTCCCCGTCCATGCACCGTACCTGCATAGACCCATCCA
CTTAAGCTCTCCGATCATCGCTATTTTCTGGCGTCTTCTTCGTGCGATTTCATCACCTCAAAACGATTCTTAGTCACCTGATCGCAATCCAACTCCTGCA
ACATAGCTCCACAATTTAGATAAGCTTCATCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTATACCAGGTACTGCTTGTGTATTCGGCCATATCTCGT
TTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAAACTCGTCCGCGTCGAGATTACCCTCCCAACTATCTTCCGGCAGCAGTGCTTCATCAAAA
TCAAACCGACTCGCCTCATCCACATTCAACCCACCCGTTGGGCATTCTGGGAATGCGCGAACTAGCTTCAGCTTAGACACGTGGACTTTTGGGAATAGCC
GGTACGGCATGCCCGCGATGTCCAACTTTACGGCGTAATCACCGCACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCTAGCTTTTGAGCATA
TCCTTCCTTGACTCGATCCAGATATAGCCAAACTCGCGACCCGCGATCGATATCCAATAAATCTCGATCTTCATTATGTCGATCGGCTCGACCTCTGATC
GCAACCTCCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGTATACCATATCTCCATCTTCGGGCATCTCGATCCCGGGGTTTAGTGC
TTCCCAACGGTAAGGTTTCTTCCTAGATCGATCTTGGGTCCCAACCGTGAATCAGGTAGAACGGTGTATCTACTCGAATTCGATCATGAGCGGTGTTGAT
CGCATAAGTCAATCGCTCTGCGTATTCGTCCTAGTCCTTTTGATTTTCATCCATGACATACATCTTGATCGATCGAGTCAACGTCTGCACCATGCGTTCG
GCCGTACCATTAGCTTGCGGTCTATACGCCATAGTGGCCCGTTGTTTTTGTCCTGCGATCCGATTGAATGGTGGGAAGAAATCAGACATAAGTCTCGGCT
CGATCATGGCGTATCGCCTCACTCGCACCGAATCGTCTGAACACGCACTCCTCGTAATTTTCTGCGATCGTCTGCGCAGATCTGGACGAGCTTGCCTTTG
CGATCACATATCCCGAGAACAAATCAACCCACAGCAACAGCTCGGTGTTTCCTCAAAGGATCTTGGCAACGAAGGGATGTGATCCATAGCTATAATCTGA
AAAGGGTACGTTGATTGCATATTACCAGGTGATCCGCTTCGATCCTCCGGCCATCCTTTTCCCGTTTCACAATCTACACACTCTCCCACATACCGCTGCA
CCCTTAGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCCTTGATAGGTACGGTCGATTCCTTGGTGACCACCCTCCAAAATTGCGTGGTAGTGGCG
CAAGAAGTCTCGCTGTAACTGTTCTGAAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGAATAGCAGCCCA
CTTTGGTCTACTTCATAGTCCGGTGCGATCAGGGTGCATACCTTAGCTTCAGCTGCCGATAATTTAGCTATGTCTCCAACCAGATATATCTTCAAACTAG
GTATCCAGTTTTCTTCGTCTTGTGCTTCGTTAATACGACCAATCCGTATATGCTGCACAACCTCTTCCTGTAAAATCCTGGGCTGACATCGTCTTCTTTG
GGCTGTTCGAGTGATAGCCGCAACTTTGACCGCACGATCAACTCGTTCTGGTAGTAGTAATTCATTTAACCGATTGAGAGTAATCAGGTCCTGACGCTCT
TGATCGGAAACTACAACTGTCCCTTTCTCTTGCCGTAGAGCGACACTCGCCAATCGATCTGCACTCTGATTCCAGTCCCGCTTCATGTGCAAGAACTCGT
GGGATGGCCACGATCGTAATCTCTCCATAGCCCTATGCCTCAATAACTGTAGTCCCGGCGCTTTACAGTTGATTTCTCCTCGCATTTGACGGATCACCAA
ATTCGAATCTCCGCAGATAATCACTCGTCCCCTTGCCTTATCGGCAAGCAAATCGAAACTATGGAGCAGCCCTCGGTATTATGCTTCATTCACGGTTAGA
TCAGGGATATACTCGGAAGCAGTAGCCACAATCGTCCATTCCGGCAGTTTCCATATAATCGCGCTGTATGCCCCACCCTTCCTTTTCACCCTGGCTGATC
CATCGAAATTGGCTACCAGCAGGTTTTCATTCACACCTACTGTGGATGGTGGCATGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGATGATCGCAATCAA
TACTTCATCTACTTCTTCACGAGGTGTTATGCTTGCCGCAGCATGCCGAGTATTTCATCTTCTCCCTTCTCAGATCGCCTAATTTTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATCAGGTCTT
ACAGCAGAGGTAGGTTTTGGAGCCTCACTCACGTGGTTGATCTCGTGGAAATCTGCTTCACGCAATTCGTACAACACTGATGCGTAAACTGCGAAGTCTT
CAATGAATCTACTGTAGTAGTTGAGACTTCCCAAAAATGACTGCATCGCTTGCAGCGTCCGAGGGAACGAGATGTTCACCAACGATCCCAGATCTTTCGG
ATTAGCTTCCAAACCTGCGAGCGAGATTTGGTGCCCCAGGTATTCAACCTTGCGACGTCCCCAAAAACGTTTGTCCAAACTGATCGACAAATTCCACTTA
TCACACACCTCCAATAATATCTCCACTTTCTCATACAGGGCCTTCCACGACGTAGCTGGTATTAATATGTCATCAATATAAGATCTTCGACCCAACACTG
ATGGTTTTGGATCAGTATCTGGTTCACCATCAGTGAAGGCATTGATCAACTTCGGCGATCCCGCCGTGGTTGATTCGGATTTTACGCCGATTTTCAAATA
CCCATACCGAGCATTATCAATCAAACGTTGGTAAATCTGTGGAGCATTTTTCAACCCTAAAGGCATCCGTAACCACTCAAAAAACCCTGACAGTGTGATA
AAGGCGGAAATCTCCCTTGCTCTTTCCGTCATCTCCACCACCCAAAAACCACTCGCCATGTCCAGAGAGCAGTACCACATAGCTTTATCCATGTCTTGCA
ATAGTTCTCTGATCAGTGGCATCGGATACACCATCAACCTAGTCAGCTGGTTCACCCGCCTGTAATCAATACACAGCCTTATATCTTCTCCGTTTTTCTT
GATGATCACCACTATGGGGGACGCCCATGGTGATGTAGATGGTCGAATGATCTTGGCCGACAGTAATCCTTTGATCAGATCGGCGAGTTTTCTCGGAACT
TTGGTGCTACCAGTTGGACCCGTTGTGCATGTCACAAACTGCCCCACCCGCCGCAGGAGGTAGGGCGTTACCCTTTCCAATAAGTAGATGCCGGCTCTTC
CGAATCATTTGGCGCAACTCCTCTTGATCCTCGGTTCTTGGGGTGCCGAAATCGCCTACTTGAATATCATCAATCGTTATTTCTTGTGTGGGCGTAACCA
CTTCGGGAAGAACTGCATGTGCTGATCCACATCTTCCGCGAACAACTCGCCGCCATCATGGTAATACA