Description :
From Genome Similarity Track
Location :
Scaffold_160:66616- 73525
Transcript NameFunction/comments
g13139.t1hypothetical protein
g13140.t1hypothetical protein

Sequence
6909 bases(100 bases per row)
CCGTCGCGAGACGAGGACGAGCCTATGGAGGCCAACGTTGTCTCCAACAACCTCGACGAGGTCCAAAGCCAGCAACTGGCCGCGATGGAAGAGGCGCCCC
GCGCCCAGCGTCCGATAGCACGGCCTCTGCTCCACCCGAGCCGCCGTGACTACGGCTTTGAGCCACGCGACCCCAACGAAGTGGCTCGCCTCGCGGCGTC
GCAACTGTTGAATGACTATGTCATCGGGCCCGCGGCCTATTCCAACGAAGAGGTTGCTCAGCGAGAAGACCTCCGCCAGAGGTTGCTGACGCCTCAGCTT
ACCACTCAGCGCGAGTACCGTGAACGCCTGCAGCTCCAAGCCCGGGGGGCGTCCGTTCCGCAAATGCGGACGTATCCAGTGGTCCTACTGGCAGGCGAAC
GCCAGGAGCAGGATGTCGCTCAATTCGAGCTCTGGGTGGAAGGGGCTCGTAAGCTCTCTTCCATTGTCGCGCTGCAAGCTAGCTTCAAGAAGGACGACGT
CCTGTTAGAGCGTCGGCTCCGGTTCGCGTTCGCGAAGTTAAAGGCGAAACGCCAACTTCCTTCGGGTTTCCAGCCCCGCCCTGCGCGGACTCCTCAACAT
GCTCCTCCGAGCTCTGCAGACCTTCCACAAGGTGGATCGTCGGCTGCAGCAGCCCAGGGTCGAAGCTTGAGCTCAGCTGTTGACCCCCTCGCTCCCCGAC
CTACTGCCGGGAAGCGGGTGACGACCGACGCGCCGGTCGCGAGCCCCCAGGGCGCCGTTGATCGTTTCGATCAAAAGCGTCCACGACGTCAGGGCAGTCT
TGCCGGAGGGGTACCTCAAACTCCCATGAGTTCTGCGAGTGGAGGTACCCTCGCCACTTCACCAGATACTGGTATTGATTTTGGCGGCGACGCCGAGCCA
CAATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGCAACGCCGGTGGCGGACGCTGAGTTGCACTGGGTGCATCGTTCGGAGCTTGAGGACG
CTTGGAACGCGATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGTGAGACTCTCCATCAGGCCGAGAACGCCTATGATCGCTCATGGCATGAGATTGA
TCAGCTCCGGGAGCACGTCGACTGGTTCGAGGCCCCAGCTGCGCTGGCGAACCGGGTCTCCGACCTTGAGCGAGGTCTGGCGAGGTTGGAGGGTCAAGTC
GACCTTCTGCTGCGACTTCAGCAGGGTGCTGTGGCTGCGCCACCTGTGCACGTCCCGGTGCCAGCGCCTCCGCGCTCACCCGCGCCGGGTCCCGGTACGG
CTTGGGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCACGACTTTGAAAGGTCCG
ATGAAGCGTGGGCGCAGCTTCGTCTTGAAGACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGCGTTTAATAAAACCAAGTCTCCGACTGCGTAACTTT
CAATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCTTGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAAGACACTCAGACGCGTTGA
CAGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCTGAACCACGGAGTGGTAGC
GTCAACGGGACGCGAGGGTGGGTGAGGTCATTCACGTAGAACGGGGTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGAGTGGAA
GCATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACACTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTGGATG
ATCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGACTCG
GGCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGGTGTCCGGCACCACCGCTAGATGAGCCATCTTGCTCA
AACGGTCGACAAAGTCCATGATGCCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCGAACACAAAGTCCATACTCATGGACGCCCAACACCCAGAGGGTAC
AGGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGGGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTG
GGCTACCAATAGGAGAGGCTCACAGAGCCATAGATCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTGTCGTGTGCCTCATAGAGGATACGATATTTCA
GATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCTGTGCTGTAATACAGCAGGCCATCATCGAGCGAATATCGATGCAGCCTCGCGCG
TAAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCTCCCAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAGCGCGG
ATCAAGTCCGTCACGGACGACGTCACAGTCGTGACATGTGATAACTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAGGCTTGTACTTAACC
TCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGATCAGTAAAGA
TGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGC
AGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGATGCGTCACAG
ACGACACTAAACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGCTCGGTGTCCC
AGGCCCACTCCGCATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCGAGGCCAAGCCA
CTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCT
AAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGT
GGTTGTCCACATCTGACTTCCCGTGCTCCGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGAAAAGCTGCGT
CACTAGACGATTGAACGTCGCGGGCGCGTTCGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGCTGTCAGCGGA
ATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGAGTACATCCTTCC
TAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTCGG
CGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGGCAAGGGCCAC
TGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACAT
CTTGGTATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTGTCCTCCAGGAC
TGCTTCGTCCATAAGGGAAGACGAATTTAACTCATCTTCAGGTCGTATAATAGCGACCTCGGCTAATTCGCCCGCCTTTAAGGCCTCGCCGAACTCGGCA
ATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCCATTAACGAGTGTAT
ATAGCTGTTCGCTATCCACCACTCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGTCTCCGCGCGGA
GACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACCTCTTGTTGCTTCATCGGAGCGTCGACGTCAAACTCGACA
TCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCAACTCCACACGCATCGTTAGGGCTGGGCCCAGGATGCCTCGGCTCGTGGC
CGACCGCGCCATCGTTGGCACGCAGCGATTCTTCGCCATCGTGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAGGGCTATGCCC
ACGATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGT
ACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGACACGCCGATGTCTAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCC
AATAGCGCTTTTGCTTCCTAACAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAAT
CCATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATCGAAGTCCAGA
AACTTCACGCCAAGGTTCACAGCAACCTTGGACACCGTAACACGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCAT
CGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAAAGCCCTTCAC
GGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGGCTAAGCCCTGCTGACCTCCTTGCTGAGGCTCAACAGAACT
TAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGCAGGGCTTCGGCTCGCCGGAG
TCTGGCGCTGCTTACGCAGCGGGCAACCTGGTCGCAGGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGCGCTGCTCGGCAGCAAGAAG
CTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGTCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGTCTGCGACGTTCCCCACCCG
GCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCATCGCCACGCTCACTGCATCTTCAAAAGAGGTGGGGTGAACTCGGAATACTTCCGTTCTGGCCACGC
CAGTGCGGAGGCCTTCCATGAGGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGTTCGTAACTCTTGGACGAAGTC
CACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGTCTGGTTAGGCGGCGAGAACACTCGCGACAGCTGAAGCTTCAGC
TGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTTCCGGGCCTGGCCACCCAGCTTGGACACGGCCAGCGCCACGCGCT
GTTGCTCCGTCTGGAGTATGTCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGCCTTCAAAGGTTTTCACACT
CACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGGGCGTCGTAGACGCTGTCACAGCCGTCATCTTCTGTTGTAGATGTTCCAACAGA
GCATTCTCATAACTCGATAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGCGAAGCAAGATTAGCCACACCTTCCGGGCCCAACAAGGACATCA
GCTTTTTAAGCCCGTCCTGTTGGTTCGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTCAGGTGTAGGATTGACTACAAG
TGCTACCAAGTGCAGCAGGGCTGCCGTAGCTCGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAACCTAGGTTCTATACCAGAACC
AAGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTTCAAAACGTGAACTGATTTTTA
TTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCATAGTGGATCCTAGTAATATGCATGACGGGTGGCTGTGAGG
CCACCAACCTAAGTCTCGTGTACACACACCAACTTGGGTATGCACACCATTTGTGTGAAACACACTATTCGTGTACGATACACTAACGGGTACGTGTAAC
CCCGTTACA