Description :
From Genome Similarity Track
Location :
Scaffold_1054:6660- 8552
Transcript NameFunction/comments
Phyta_totarag11875Amino Acid/Auxin Permease (AAAP) Family

Sequence
1892 bases(100 bases per row)
GTAAAGTTCAACATGGTTAGGCCAACAATTAATTCTCGTGAGCAGCAGTGTAGTTATAGTACACGGTGTTCTCGAACTCTGGCGCGCAGAACGGAAACGa
tgtgtcgtcgtcgctagGAGCGAACAAGTTCTTGCCAGACGTGTACGTCACATAGCAACCCAAGCAGAAGCACACCACGATCACGATCAGCGCCGGGATC
TTCTCCCACATCGGAAGTACactccacttcttcttcaaaagGAATACAATCGGCAGAAGGATCGAGTTCACCGTGATGCACGACGAGCCGACAAAGTCCG
ACAGGTCCGAGAAGTGGTCCTTCAGGAGCACCGACGCGATCACGAGGATAACGATAATCACGACACGAAGAGTAACGTACTTGATAGTGTTGGCGCCACG
GTACTCAGCGGCCTCAGCCTCGGGCTCACCCAAGTGCACGTTCTCGTTATCGGCGACAGAAATGAACGAGCGCTTGGAAGCACGGGACTCTTTCTCCGAg
cgctcagcagcgtcagcaggaGTGGACACATCGGCGTAGTTCAACAGGTTGTTCTcgacgtcagcgacgacaggCTTGTGCATGCCAAGCACGATGCGCT
CGGCGATGTAGAAAGCCGGGTTCAGGATAACGGAGAAGGCGATCGTAATGTGTAACTGCATGAAGAGGTAGGCGAGGACAACCATACCCCAGTCTGATGC
GAAGCCGAGCGTGGTCAGGCCAGTCTCCGCGTCCGGGTAGATCGACCACAGCAAGTTGCCCGAGATCTGGCAGCCGACAGCCGAGTACGCTGTGCTGGCA
AGAACCAAGAAACAGCACGATATGAACGCAATGGTCACGCCTACGACACGGGGCATGCGCGTGGGGTCGCtgtgctgacgctgcagcgccggAATCACGA
TACCGGCGCCGTACGCGAGAGCCAAGTTGCCGAAAGCGCCAGCTACTTGCTTGAAGCTGAGGTCGGGCGAAGGCACACTCGAGTGACCGCGCATGCCGTA
CAtcacgacggcgacgccaATCACATCAGCGATAAGCGTACCCATGCAGCCCGCAAaggcagctccagctccttcctTCAGAGTCGGCACCAGACACACA
GGTAGGCACGAGAACGCCATGAGGATGATCCACGTCGTCGCGCTGAAGGCGCCTGGGAAgaggccatcaagaaggctGCCGCCCAACACGAGGAACACGC
ACGGCACCAGCAGACAGTTGGCCATCTGCGAGATGACCGAAAGGTAGCGGCCAGGCTTGCCCATGCACCACTCGCCGAGATCGCCGTAGGTCTTGACAGA
TCGCGGAGCGAGGAGCATAACGCGGCAGATGGCCACCGAGGAATACGTGTTGGCGAAGGCCATGAAGGCCATGGCGATGACTGCAATCGCGGGGCCGGCG
CGGGAAAAGTTGCCGGGCATACCAAGCGTTCCAATGCCGTAGACGCAGCAGAATAGATTGAAGGCCGCCTTGGCATCTTCCAGCGTGAAGATAGCTTTAC
GCGCCATTCTGGAGTCGGTTGGGTCGGTCGCTCGGGAGTCAGGCAGAAAATTGGAGACTGAGCTTCAATGAGGTGGGCAGCGATGCCTTCTCGGCCCCAG
CTCAACAAACAGGTCAACTAGCGAAGTTCTCGGCAAGCGCGCCACTGCTCAGTGAACGTTAGCCCCGGGTGAACGGGTTGCAGCAAGGGCCTTCTGGGAG
TGAGAGCACGGCCGCTATCAGCATTCTAGGCGGTGTCAGATGGCGATGGGCCTATGAGCGCGTTCAAATCCCAGCACCGCGCTTTCTGGTGCAGCGTTAA
GCGCTCACGCACCGGCACTGACACCATGACACCAGATTTTGTTCTGCCAAAGACCCGGTGCTGCCCAATAGCAAATCTACACTTGGCGTCCT