Description :
From Genome Similarity Track
Location :
Scaffold_19:6660- 8438
Transcript NameFunction/comments
Hyaar_Emoy2803254hypothetical protein

Sequence
1778 bases(100 bases per row)
TCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTTTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCCGAATATAACTTCGA
AATGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCTTCATTC
ACTGAATTAATCGATGCGGCTTATGCCAAGGATGAACAATGTGTAGTTTTGCTACGTGCTCTTGGCAGCGAGGAGTTTAAAGCTCGGACATAGAATTTTT
GGCACGCTTACGTGCGAGGCTACATCGATATTGTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGCTTTCCCTCAT
GATGAGGAGTTGAAGTATCGAATACTCTATGAGGCACATGATACCGCTGTAAGTGGTCATCTCGGTCGTGAGAAGACCCATAGCTCCGTGAGACAGGCTT
ATTGGTGGCCCAAACTATACAAATGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATTCGGCGGAGCCGCTGGC
TTGTCTGCCTGTACCAACTGGGTGTTGAGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACTGGCATTGTGGTCTTT
GTTGACCAATTGAGCAAGATGGCTCACCTAGCGGCAGTGCCGGACTCCATTGATGCCGAAGGTAACAGCGAAGCTGTTTATCGACCGTGTGTTACGACAA
CATGGTTTACCAGTGGCAATTGTCTCTGACAGAGATCCCCGCTTCGCTGGGAAGTTTTGGAAGTCCATCTTCAAAGTGCTCGGCACTCGTTGGACATGTC
CACAGCGGATCATCCGCAGACCAATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGTCTATGCGTTGT
AGCTCCATGCTCCCTGTATTCGAATTTGCGTTGAACAACGCTGTTCATGCCTCAACAGGCTACACTCCGTTCTACGTGAACGGTCTCACCCACCCTCGCG
TTCCGTTAACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGACGATAGGCTTGCTGATATCAGCCCTGATACTGTTCAAAAACAGGTAGG
CGAGTTTCTTGCAACGCGATTGAATGTCTTAAGACATGTGCGTAACGCAATGACTGAAAGCCAAGACCAACAAAAACAACAAGCAGATGCTAAAAACAGA
GGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTCAAGACAAAGTTGCGTC
CGCGCTTCATTGGACCATTCACGGCCGTTGCTAAGAAGGACTTGCGTATACGCTAAACCTTCCGCGCACATTGCGCACACATCCTGTGTTCTACGTTGGC
CTGCTTAAGCCGTATCGGGATCCTTCCACGTGAAATTGGAGGCGCTTGCGCCGCGGAAGCTGGCCTTGCCATCGATTGCTGCATCCGAATCAGGAGGTCA
AGCTGGGCCTCCATCCGGATGTGACCCGACTCCAACGTCTGAACGCGATCTTGCGTCGCGTCGAGCGCACTCTGGGTCTTACCCAATGTCTCACGGAGAT
CATTCAGCTCGAGAAGTATCTTCTCATGCTCCTCCTTCGGTACACCGACCCCCACCGACGCTGCTCGATGAGAAAGGG